 * |   |
|
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда |  Zbio-wikiNG SEQUENCING · ЖИЗНЬ РАСТЕНИЙ · БИОХИМИЯ · ГОРОДСКИЕ КОМАРЫ · А.А.ЛЮБИЩЕВ · ЗООМУЗЕЙ Темы за 24 часа [ Вход* | Регистрация* ] Форум: |
|
ПравилаПоследние 10 сообщений [ в обратном порядке ]
| Ufa1688 | Отправлен 07.06.2023 21:13 |
| Chair umpire Alexandre Juge issued a code violation before grand slam supervisor Wayne McKewen and tournament referee Remy Azemar appeared on Court 14. After discussions between the officials and the players, it was announced Kato and Sutjiadi had been defaulted. | |
| Ufa1688 | Отправлен 14.03.2023 08:07 |
| David Carrick a serial sex offender served in one of Britain’s most elite armed police units for years. He is now behind bars but his ability to evade justice has only fueled a growing distrust and anger toward police in the United Kingdom. CNN has investigated how failures may have prevented Carrick from being stopped sooner. | |
| guest: 123vega | Отправлен 12.11.2022 12:38 |
| A long, beautiful stretch of sand in Australia's tropical far north, Wangetti Beach, was Toyah Cordingley's favourite beach. It is also where she died, in what has been called a "frenzied and brutal and sadistic" attack. The 24-year-old had gone to the beach to walk her dog on 21 October 2018, as she had done countless times before, but never came home. The next morning her father found her "messed up" body half buried in sand dunes. Her beloved dog was tied up nearby, unharmed. Four years on, Australian authorities are appealing for the public's help in an international hunt to find the man they believe killed Toyah - Rajwinder Singh. | |
| Ufa1688 | Отправлен 07.10.2022 20:55 |
| In that case the shooter was said to have erupted after an argument with another soldier over a land-selling commission fee. In this case, the motive is unclear but after terrorizing the childcare center, Panya Kamrab a 34-year-old former policeman drove home and shot his wife and child before taking his own life. | |
| Mala636 | Отправлен 01.10.2022 15:10 |
| F1 Removal is a well known movers and packers company all over the UK. We have been working since 1980 providing professional moving services according to the need of the customers. We have highly trained staff for all sort of moving services during relocation. | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
|
| thomaslist | Отправлен 04.04.2022 12:11 |
| nigoal123 | Отправлен 02.02.2022 11:31 |
| List your name in the article to define who is writing it if your project requires this step. Some companies may require you to keep your name and include Your enthusiasm will show in your writing your social media channels of and will be much more and contact information to engage with their readers engaging for your readers. You may need to speak with the writer makes an argument. |
|
| watchesbiz | Отправлен 13.12.2021 10:32 |
| -Ъ- | Отправлен 14.05.2011 15:48 |
(RJ Dio @ 12.05.2011 11:05)  да уж, праймеры дизайнить- не форезницы лепить! Все могем, едренть, как Леонардо наш, не побоюсь этого слова, Да Винчи- и велосипед с вертолетом изобретать. и картины писать, и наукой заниматься и еще бездну всего-всего. И секвенить, и диагностикумы делать, и задачки сложные тонким перышком в тетрадь. Это ведь наверняка далеко не все- и грибочки мариновать, и рыбку поудить, и в форуме помодерировать. А стихи, во- стихи не пишите? Помогу с изданием нетленкиТы скоро автограф у Генсека будешь просить, так чта...  |
|
| genseq | Отправлен 14.05.2011 07:46 |
| 1003 11 May 2011 DNA file: MYC.SEQ [10996] >gi|11493193|emb|X00364.2| Homo sapiens MYC gene for c-myc proto-oncogene and OPTIMAL ANNEALING TEMP.: 61.9° Product length: 1003 bp; 59.0% GC Tm(prod.-less stable primer): 21.0° Primers Tm difference: 0.5° Upper:1983 (26) ->------- Lower:2962 (24) -------<- 3'-ends dG: U=-6.7 L=-6.4 ╔═══════╤════════╤════════╤════════╤══════╗ ║ Oligo │ Tm [°C]│ nmol/OD│ µg/OD'│ Mr ║ ╠═══════╪════════╪════════╪════════╪══════╣ ║ Upper │ 62.4│ 4.13│ 32.9│ 7961║ ║ Lower │ 61.9│ 3.85│ 29.2│ 7598║ ╚═════════════════════════════════════════╝ OPTIMAL ANNEALING TEMP.: 61.5° Product length: 1557 bp; 57.0% GC Tm(prod.-less stable primer): 20.0° Primers Tm difference: 0.5° Upper:1983 (26) ->------- Lower:3515 (25) -------<- 3'-ends dG: U=-6.7 L=-6.1 ╔═══════╤════════╤════════╤════════╤══════╗ ║ Oligo │ Tm [°C]│ nmol/OD│ µg/OD'│ Mr ║ ╠═══════╪════════╪════════╪════════╪══════╣ ║ Upper │ 62.4│ 4.13│ 32.9│ 7961║ ║ Lower │ 61.9│ 4.30│ 32.5│ 7565║ ╚═════════════════════════════════════════╝ > UPPER PRIMER: Positive strand of MYC.SEQ, pos. 1983: TCCGCCTGCGATGATTTATACTCACA > LOWER PRIMER: Negative strand of MYC.SEQ, pos. 2962: AGCGCAGGAATGGGAGAAAAGACA > LOWER PRIMER: Negative strand of MYC.SEQ, pos. 3515: GCCTACCCAACACCACGTCCTAACA |
|
| Посмотреть тему (откроется в новом окне) | |
· Викимарт - все интернет-магазины в одном месте · Доска объявлений Board.com.ua ·
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---
Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Powered by Invision Power Board(Trial) v2.0.0 © 2024 IPS, Inc.