Rambler's Top100
Лёгкая версия форума* Виртуальная клавиатура  English  
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы
Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда | Междисциплинарный биологический онлайн-журналZbio-wiki

NG SEQUENCING · ЖИЗНЬ РАСТЕНИЙ · БИОХИМИЯ · ГОРОДСКИЕ КОМАРЫ · А.А.ЛЮБИЩЕВ · ЗООМУЗЕЙ


Темы за 24 часа  [ Вход* | Регистрация* ]  
   



Форум: 
 

Щёлкните, чтобы внести в Избранные Темы* Предсказательная сила филогенетики -- Как за деревьями узреть лес? --
ИнтерЛабСервис - передовые технологии молекулярной диагностики
Операции: Хочу стать куратором* · Подписаться на тему* · Отправить страницу по e-mail · Версия для печати*
Внешний вид:* Схема · [ Стандартный ] · +Перв.сообщ.


 
Добавить сообщение в темуСоздать новую темуСоздать голосование
Участник оффлайн! AiAi




 прочитанное сообщение 19.04.2006 12:35     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #1 множественное цитирование
Вопрос
Филогенетика - штука занятная и многомудрая. Множество алгоритмов придумано, превеликое множество статей мужами многомудрыми опубликовано. Строят деревья филогенетические и ориентированные и не очень, пользуя методы математические (от изощренной статистики до теории групп). Вот только не узрел я средь леса сего ни одного предсказания неизветных доселе предков на древе эволюционном. Обладает ли славная наука филогенетика силой предсказательной?

Поясню на примере. Пусть есть у нас четыре генома A,B,C,D, четырех тварей в родстве близком находящихся. Загрузили мы их в программу филогенетическую и выдала она нам древо:

A == B===C
........ |
........ |=== D

Т.е. A- предок B, a В - предок С и D.
А теперь загрузим в программу только три из этих геномов A,C,D.
Способна ли программа однозначно предсказать, что должна существовать тварь B?

Сообщение было отредактировано AiAi - 19.04.2006 12:37
Участник оффлайн! daniil naumoff
Постоянный участник
Moscow, Russia



 прочитанное сообщение 19.04.2006 13:20     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #2 множественное цитирование

Таких деревьев программы не рисуют (ныне существующие организмы являются современниками, а потому не могут находиться друг с другом в отношениях "предок-потомок") и вообще построение филогенетических деревьев возможно лишь при наличии не менее четырёх представителей анализируемого семейства.

Посмотрите http://zbio.net/bio/001/003.html - думаю будет полезно.
Участник оффлайн! AiAi




 прочитанное сообщение 19.04.2006 15:15     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #3 множественное цитирование

(daniil_naumoff @ 19.04.2006 14:20)
Ссылка на исходное сообщение  Таких деревьев программы не рисуют (ныне существующие организмы являются современниками, а потому не могут находиться друг с другом в отношениях "предок-потомок") и вообще построение филогенетических деревьев возможно лишь при наличии не менее четырёх представителей анализируемого семейства.

Посмотрите http://zbio.net/bio/001/003.html - думаю будет полезно.


Так вовсе не обязательно гены современников сравнивать. Пример:
A - мамонт (Mammuthus primigenius), С - азиатский слон (Elephas maximus),
D - африканский слон (Loxodonta africana). Существовал ли "B"?

На эту тему есть хорошая статья: http://www.ncbi.nlm.nih.gov/entrez/query.f...l=pubmed_docsum

А про "не менее четырех" не согласен. Это ограничение лишь для методов основаных на выравнивании последовательностей, да и то, полагаю, не для всех.

Статью Вашу читал, по ссылке на нее и попал на этот форум. Интересно, и, что редкость, практические советы в изобилии. Спасибо!
Участник оффлайн! daniil naumoff
Постоянный участник
Moscow, Russia



 прочитанное сообщение 19.04.2006 16:16     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #4 множественное цитирование

1. На сколько я понимаю Mammuthus primigenius, Elephas maximus и Loxodonta africana были современниками до тех пор, пока первый не вымер.

2. Что значит <Существовал ли "B"?>? Вы имеете в виду был ли у двух слонов общий предок, который не был предком мамонту? Так в указанной Вами ссылке прямо утверждается обратное: "Phylogenetic reconstruction of the Elephantinae clade suggests that M. primigenius and E. maximus are sister species that diverged soon after their common ancestor split from the L. africana lineage." То есть в Ваших терминах L. africana - это "A" (конечно, если мы рассматриваем бескорневые деревья). На самом деле никто из них не является предком для остальных.

3. А какие методы "не основанные на выравнивании последовательностей" Вы имеете в виду?
Участник оффлайн! Chromocenter
Постоянный участник
Вниз по Янцзы от Ухани на право, за озером



 прочитанное сообщение 19.04.2006 16:42     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  ICQ
Цитировать Поместить сообщение в колонку новостей  URL #5 множественное цитирование

На мой личный взгляд (Даниил, не судите строго), составлять филогению ораганизмов на основании сравнения одной последовательности (а скольких ещё можно, если последовательности выравнивать?) не слишком надёжно: при этом мы упускаем из вида два обстоятельства: во-первых, гены могут быть перенесены горизонтально (в случае со слонами - в результате вирусной инфекции), во-вторых откуда нам знать, что избранный нами ген или участок генома изменялся вместе с эволюцией организмов в целом? Вдруг эволюция организмов шла, а он оставался почти неизменным в какой-нибудь одной ветви или наоборот в другой стал измется как умалишённый? Вот и получится, что два организма разошлись недавно, но на этом участе скопилось у них множество мутаций и мы сочли, что разошлись они давно и тем самым посчитаем, что не было у них общего предка, относительно какого-нибудь третьего организма. Так что деревья могут только с большей или меньшей уверенностью говорить о родстве организмов, но, мне кажется, не о эволюции как таковой.
AiAi приведённое вами дерево будет выглядить, скорее всего вот так:
A...B....C.............D
|__|___|..............|
.....|__________|
................|

Поскольку В, если он предок C и D, то находится между ними. Однако если В не известен, то всё, что сможет сказать программа - это то, что D и С похожи друг на друг друга больше, чем на A. Однако кто сказал, что они не могли разойтись друг от друга очень далеко, тогда как A остался похожим на общего со всеми ними предка? Даниил, невозможность выравнивания меньше чем четырёх последовательностей обойдём, сказав, что изображённое здесь - только одна ветвь большого дерева.

Сообщение было отредактировано Chromocenter - 19.04.2006 20:56
Участник оффлайн! daniil naumoff
Постоянный участник
Moscow, Russia



 прочитанное сообщение 19.04.2006 17:31     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #6 множественное цитирование

1. Можно несколько последовательностей (каждая из которых присутствует у всех рассматриваемых организмов) "объединить" в одну и на основании неё смотреть филогению.
2. Да, филогенетические методы подразумевают, что мы рассматриваем достаточно длинные последовательности, чтобы пренебрегать локальными "явлениями", в т.ч. селективной консервацией отдельных сайтов.
3. Факты горизонтального переноса как раз и выявляются на основе сравнения филогенетических деревьев, построенных на основе разных белков (фрагментов ДНК).
4. Разная скорость эволюции должна влиять на длины ветвей, а не на порядок ветвления (хорошие программы это учитывают).
5. В приведённом примере речь шла о митохондриальной ДНК, сомнительно, что её можно перенести посредством вируса.
6. Анализируя последовательности 1 определённого семейства белков, мы именно его (этого белка) филогению и изучаем, а вопрос о возможности её экстраполяции на организм в целом более сложный и нуждается в наличии дополнительных данных. С эволюцией организма обычно отождествляется только эволюция его рРНК.
7. Думаю, что Вы не правильно поняли AiAi. На его древе время идёт не снизу вверх, а слева направо.
8. Выравнивать можно любое число последовательностей, в т.ч. (в простейшем случае) - две. Однако филогенетический анализ осмысленен только при наличии не менее 4 объектов, так как для трёх возможен лишь один вариант топологии "Y".

Сообщение было отредактировано daniil_naumoff - 19.04.2006 17:34

Всего благодарностей: 3Поблагодарили (3): Chromocenter, plantago, mlog
Участник оффлайн! Nastja
Постоянный участник
Новосибирск



 прочитанное сообщение 19.04.2006 17:32     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #7 множественное цитирование

Есть такая штука, как восстановление гена-предка по построенным деревьям! Помню на какой-то лекции Колчанов про это рассказывал. Там проанализировали какой-то белок у разных организмов и потом синтезировали его возможного предка. Так у него что-то было круче чем у потомков - то ли стабильность, то ли скорость работы. В общем, никаких ключевых слов уже не помню, но что-то информацию найти можно.
Может это немного не в тему, зато интересно smile.gif

А филогенетические деревья как у автора темы можно строить для вирусов гриппа, например.
Участник оффлайн! daniil naumoff
Постоянный участник
Moscow, Russia



 прочитанное сообщение 19.04.2006 17:41     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #8 множественное цитирование

(Nastja @ 19.04.2006 18:32)
Ссылка на исходное сообщение  Есть такая штука, как восстановление гена-предка по построенным деревьям! Помню на какой-то лекции Колчанов про это рассказывал. Там проанализировали какой-то белок у разных организмов и потом синтезировали его возможного предка. Так у него что-то было круче чем у потомков - то ли стабильность, то ли скорость работы. В общем, никаких ключевых слов уже не помню, но что-то информацию найти можно.
Может это немного не в тему, зато интересно smile.gif


Химический синтез do novo целого гена? Никогда не слышал о таких эксперементах. Это должно быть весьма недёшево. Или они просто сайт-направленным мутагенезом слегка "поправили" один из природных вариантов?
Участник оффлайн! Nastja
Постоянный участник
Новосибирск



 прочитанное сообщение 19.04.2006 18:10     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #9 множественное цитирование

Подробностей не знаю, увы. Как-то это все смешно называлось... что-то вроде молекулярной палеонтологии.
Участник оффлайн! AVP
Постоянный участник
New Jersey



 прочитанное сообщение 19.04.2006 18:14     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #10 множественное цитирование

(daniil_naumoff @ 19.04.2006 10:41)
Ссылка на исходное сообщение  Химический синтез do novo целого гена? Никогда не слышал о таких эксперементах. Это должно быть весьма недёшево. Или они просто сайт-направленным мутагенезом слегка "поправили" один из природных вариантов?


http://www.genscript.com/gene_synthesis.html
Участник оффлайн! daniil naumoff
Постоянный участник
Moscow, Russia



 прочитанное сообщение 19.04.2006 18:15     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #11 множественное цитирование

Только, наверно, не по "построенным деревьям", а по множественным выравниваниям. Расчитывается "консенсус" - вот и "предок".
Участник оффлайн! Chromocenter
Постоянный участник
Вниз по Янцзы от Ухани на право, за озером



 прочитанное сообщение 19.04.2006 20:40     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  ICQ
Цитировать Поместить сообщение в колонку новостей  URL #12 множественное цитирование

"Расчитывается "консенсус" - вот и "предок". "
На каком основании консенсус - предок? Т. е. логично для общего случая предположить, что если известных генов-потомков достаточно много, то они все дивергировали от общего предка примерно по всем направлениям, но вдруг окажется, что консенсус - нефункционален? Или что по каким-то причинам ген в своей эволюции "сползает" в какуе-то "одно сторону" изменчивости (то есть в разных эволюцинных ветвях жизнеспособными оказываются мутанты с похожими изменениями этого гена), а все прочие варианты оказываютя дефектными и потому организмы с ними и не выживают? Тогда консенсус уже не будет общим предком.
Да, пример AiAi я понял не верно, но сути дела это не меняет. Сейчс исправлю.
"С эволюцией организма обычно отождествляется только эволюция его рРНК."
А почему? Как-то помню спросил у одного микробиолога, занимающимся и этим тоже, об этом: почему этот ген не может переносится горизонтально (причём у бактерий!!!) и он ответил, что "думают, что не переносится". Я видел множество древ построенных именно на этом гене, но вот почему делается такое допущение - я до сих пор не понимаю.
Участник оффлайн! daniil naumoff
Постоянный участник
Moscow, Russia



 прочитанное сообщение 20.04.2006 11:15     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #13 множественное цитирование

(Chromocenter @ 19.04.2006 21:40)
Ссылка на исходное сообщение  "Расчитывается "консенсус" - вот и "предок". "
На каком основании консенсус - предок? Т. е. логично для общего случая предположить, что если известных генов-потомков достаточно много, то они все дивергировали от общего предка примерно по всем направлениям, но вдруг окажется, что консенсус - нефункционален? Или что по каким-то причинам ген в своей эволюции "сползает" в какуе-то "одно сторону" изменчивости (то есть в разных эволюцинных ветвях жизнеспособными оказываются мутанты с похожими изменениями этого гена), а все прочие варианты оказываютя дефектными и потому организмы с ними и не выживают? Тогда консенсус уже не будет общим предком.


Конечно консенсус - это не предок, это лишь очень грубая схема, дающая понять как можно "расчитать" предка по современникам. Реально часть линий потомков оказывается перепредставленной, а другая - недопредставленной в базах данных, что обесценивает консенсус. Ваши рассуждения тоже вполне справедливы.

(Chromocenter @ 19.04.2006 21:40)
Ссылка на исходное сообщение"С эволюцией организма обычно отождествляется только эволюция его рРНК."
А почему? Как-то помню спросил у одного микробиолога, занимающимся и этим тоже, об этом: почему этот ген не может переносится горизонтально (причём у бактерий!!!) и он ответил, что "думают, что не переносится". Я видел множество древ построенных именно на этом гене, но вот почему делается такое допущение - я до сих пор не понимаю.


Поскольку никакой организм (вирусы не обсуждаем) не может существовать без рибосом, то гипотетический перенос рРНК должен происходить в клетку, уже имеющую свою рРНК. Одновременное нахождение двух типов рРНК в одной клетке почти неизбежно приведёт к проблемам в функционировании рибосом. Такая особь не сможет конкурировать с "диким типом". Рибосома - огромный комплекс с многими десятками компонент (рРНК, белки), замена одного из них испортит согласованную систему.
Участник оффлайн! AiAi




 прочитанное сообщение 20.04.2006 14:27     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #14 множественное цитирование

(daniil_naumoff @ 19.04.2006 17:16)
Ссылка на исходное сообщение 2. Что значит <Существовал ли "B"?>? Вы имеете в виду был ли у двух слонов общий предок, который не был предком мамонту? Так в указанной Вами ссылке прямо утверждается обратное: "Phylogenetic reconstruction of the Elephantinae clade suggests that M. primigenius and E. maximus are sister species that diverged soon after their common ancestor split from the L. africana lineage." То есть в Ваших терминах L. africana - это "A" (конечно, если мы рассматриваем бескорневые деревья). На самом деле никто из них не является предком для остальных.

Интересует возможность обнаружения на эволюционном дереве неизвестных нам предков. Вот и пытаюсь понять, могут ли филогенетические программы такое?

(daniil_naumoff @ 19.04.2006 17:16)
Ссылка на исходное сообщение 3. А какие методы "не основанные на выравнивании последовательностей" Вы имеете в виду?

Выкладываю несколько статей о таких методах:
http://www.telega.ru/genom/
Участник оффлайн! AiAi




 прочитанное сообщение 20.04.2006 14:43     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #15 множественное цитирование

(daniil_naumoff @ 19.04.2006 18:31)
Ссылка на исходное сообщение8. Выравнивать можно любое число последовательностей, в т.ч. (в простейшем случае) - две. Однако филогенетический анализ осмысленен только при наличии не менее 4 объектов, так как для трёх возможен лишь один вариант топологии "Y".

Даже для трех единственный вариант интересен, ибо кроме топологии он может ответить на вопрос: "Что из трех первично первично: курица, яйцо или петух?"
Приведу сильно упрощенный и далекий от жизни пример:

GGGGCCCCGGGGAAAATTTT "петух"
GAGGCCCCGGGGACAATTTT "курица"
GGGGCCTCGGGGAAAATTGT "яйцо"

Сравнение последовательностей с простым голосованием два из трех однозначно указывает, что первичен "петух".

Увеличение колличества объектов сравнения и усложнение схемы дает теоретическую возможность предсказывать не только наличие предка, но и его гены (вспомним пост Насти) или белки-предки.
Участник оффлайн! Chromocenter
Постоянный участник
Вниз по Янцзы от Ухани на право, за озером



 прочитанное сообщение 20.04.2006 18:06     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  ICQ
Цитировать Поместить сообщение в колонку новостей  URL #16 множественное цитирование

"Одновременное нахождение двух типов рРНК в одной клетке почти неизбежно приведёт к проблемам в функционировании рибосом. "
Подобные опыты проводились? Т. е. брали ли один организм и трансформировали его рибосмной рНК другого?
АiAi, в вашем примере петух это может быть консенсус яйца и курицы, также, если сказать, что мы не имели дела с обратными мутациями, то эти трое не оставляют цепочки, рисуя филогенетическое дерево с корнем мы получим такой красивый треугольничек, в котором каждого можем "объявить" пердком двух других.
Участник оффлайн! daniil naumoff
Постоянный участник
Moscow, Russia



 прочитанное сообщение 21.04.2006 13:59     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #17 множественное цитирование

(AiAi @ 20.04.2006 15:27)
Ссылка на исходное сообщение  Интересует возможность обнаружения на эволюционном дереве неизвестных нам предков. Вот и пытаюсь понять, могут ли филогенетические программы такое?


Что значит обнаружение? Конечно они были... Хочется предсказать каковы они были? Это можно на основе анализа множественного выравнивания, но причём тут деревья? Я плохо понимаю суть Вашего вопроса.

(AiAi @ 20.04.2006 15:43)
Ссылка на исходное сообщение  Даже для трех единственный вариант интересен, ибо кроме топологии он может ответить на вопрос: "Что из трех первично первично: курица, яйцо или петух?"
Приведу сильно упрощенный и далекий от жизни пример:

GGGGCCCCGGGGAAAATTTT "петух"
GAGGCCCCGGGGACAATTTT "курица"
GGGGCCTCGGGGAAAATTGT "яйцо"

Сравнение последовательностей с простым голосованием два из трех однозначно указывает, что первичен "петух".

Увеличение колличества объектов сравнения и усложнение схемы дает теоретическую возможность предсказывать не только наличие предка, но и его гены (вспомним пост Насти) или белки-предки.


Опять-таки подобного рода выводы делаются на основе множественного выравнивания, а не топологии древа. Хочу только ещё раз напомнить, что все нынеживущие виды - современники и не могут быть друг другу предками-потомками.
Участник оффлайн! daniil naumoff
Постоянный участник
Moscow, Russia



 прочитанное сообщение 21.04.2006 14:05     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #18 множественное цитирование

(Chromocenter @ 20.04.2006 19:06)
Ссылка на исходное сообщение  "Одновременное нахождение двух типов рРНК в одной клетке почти неизбежно приведёт к проблемам в функционировании рибосом. "
Подобные опыты проводились? Т. е. брали ли один организм и трансформировали его рибосмной рНК другого?


Не знаю. Я дал ответ исходя из общих соображений. Полагаю, что доля чужеродной рРНК, введённой трансформацией будет несоизмеримо меньшей в сравнении с родной, а потому никакого эффекта можно и не обнаружить...
Участник оффлайн! Chromocenter
Постоянный участник
Вниз по Янцзы от Ухани на право, за озером



 прочитанное сообщение 21.04.2006 17:58     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  ICQ
Цитировать Поместить сообщение в колонку новостей  URL #19 множественное цитирование

"Полагаю, что доля чужеродной рРНК, введённой трансформацией будет несоизмеримо меньшей в сравнении с родной, а потому никакого эффекта можно и не обнаружить... "
Почему? Можно ведь ввести её и с соответвующими регуляторными элементами, чтобы количества были сопостовимы. Кроме того, ведь мутации в этом гене накапливаются, значит бывает такое состояние, когда организм гетерозиготен по этому гену. Правда подобные аллели будут с большой вероятностью достаточно мало отличаться друг от друга...
AiAi, вот, к примеру вы получили два дерева с корнями из четырёх орагнизмов:
A....B.........C
|___|..........|
...|________|
..........|
..........D
и:
A....B....C
|___|___|
.......|
.......D
В этом случае вы можете сказать, что существоал некий общий предок для А и В между ними и D в первом случае, и его не было в во втором.
Участник оффлайн! daniil naumoff
Постоянный участник
Moscow, Russia



 прочитанное сообщение 21.04.2006 18:03     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #20 множественное цитирование

(Chromocenter @ 21.04.2006 18:58)
Ссылка на исходное сообщение  "Полагаю, что доля чужеродной рРНК, введённой трансформацией будет несоизмеримо меньшей в сравнении с родной, а потому никакого эффекта можно и не обнаружить... "
Почему? Можно ведь ввести её и с соответвующими регуляторными элементами, чтобы количества были сопостовимы. Кроме того, ведь мутации в этом гене накапливаются, значит бывает такое состояние, когда организм гетерозиготен по этому гену. Правда подобные аллели будут с большой вероятностью достаточно мало отличаться друг от друга...


Так Вы решили рДНК или рРНК вводить???

Мы теперь диплоидов обсуждаем? Я думал мы про бактерий говорили... У дрожжей S. cerevisiae полхромосомы забито генами рРНК и вроде все они одинаковые... не правда ли странно почему?
Участник оффлайн! AiAi




 прочитанное сообщение 24.04.2006 14:24     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #21 множественное цитирование

(daniil_naumoff @ 21.04.2006 14:59)
Ссылка на исходное сообщение  Что значит обнаружение? Конечно они были... Хочется предсказать каковы они были? Это можно на основе анализа множественного выравнивания, но причём тут деревья? Я плохо понимаю суть Вашего вопроса.
Опять-таки подобного рода выводы делаются на основе множественного выравнивания, а не топологии древа. Хочу только ещё раз напомнить, что все нынеживущие виды - современники и не могут быть друг другу предками-потомками.


Кажется я понял в чем наше глубокое взаимное непонимание состоит
Для Вас дерево - это, прежде всего, топология дерева. Такое древо задает отношения смежности узлов, быть может меру близости узлов, но не отношения предок-потомок. Для меня дерево - скорее древо эволюционное или, если хотите, генеалогическое.

На основе того же множественного выравнивания ведь можно эволюционные деревья строить? Иль я не прав?

Про предков, потомков и современников. Рассмотрим такую гипотестическую ситуацию:

В синем море-окияне, жила-была, не тужила, водоросль сине-зеленая, точнее жили-были, ибо организмов этих было превеликое множество. Неспешно проходили миллионы лет, и геном ее, столь же неспешно, слегка менялся, ибо накапливались в оном мелкие изменения, революционного значения не имеющие. Но вот однажды, у одной из миллионов особей произошла мутация революционная и появилась водоросль "красная". И не суть важно, чем эта революция была вызвана, важно то, что стала водоросль "красная" плодиться и размножаться, как оно и положено. Ну а сине-зеленые предки ее не пропали, а продолжали себе жить, и накапливались в их геноме малые изменения вплоть до дней наших. Судьба же "красной" была превратна, ибо всего через миллион лет мутация породила из нее "желтую", а еще через пару миллионов "синюю" водоросль, сама же "красная" еще через три миллиона лет скоропостижно вымерла. "Потомки" же ее до наших дней здравствуют...

Вот в каком смысле современная сине-зеленая - предок-бабушка "желтой" и "синей".

Вот и спрашивается, можно ли анализируя _сегодняшние_ геномы сине-зеленой, "желтой" и "синей", сделать предсказание в прошлое и утверждать, что у "желтой" и "синей" был (ныне вымерший) общий _ближайший_ предок неизвестной масти, а вовсе не появились они (в результате мутаций)непосредственно из сине-зеленой?
Участник оффлайн! daniil naumoff
Постоянный участник
Moscow, Russia



 прочитанное сообщение 24.04.2006 16:11     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #22 множественное цитирование

ОК, конечно на основании филогенетического анализа (а часто и визуального сравнения множественного выравнивания) можно прийти к выводу, что "жёлтая" и "синяя" состоят в более близком родстве между собой, чем с "сине-зеленой", а потому их последний общий предок не был предком для "сине-зеленой". Однако для более надёжных выводов всегда полезно иметь "внешнюю группу" (в Ваших терминах - "предка" всех обсуждаемых организмов), "внешний" статус которой известен априорно.
Участник оффлайн! watchesonline89
Постоянный участник



 прочитанное сообщение Сообщение на английском  19.12.2022 09:18     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #23 множественное цитирование

https://62e8da780bf7c.site123.me/blog/reaso...-are-so-popular
https://wakelet.com/wake/GWMJ_l3LaLVMVUbPaFWKe
https://www.vingle.net/posts/4647023
https://www.investireoggi.it/forums/members...online89.50980/
https://imgur.com/a/0WCWVRa
https://omegawatches89-95.webselfsite.net/
https://omegawatches89.gumroad.com/p/replic...ve-items-online
https://www.edocr.com/v/ay7reva1/omegawatches89/7
https://omegawatches92.mystrikingly.com/
https://blog.udn.com/omegawatches89/176264270
https://omegawatches89.seesaa.net/article/490300948.html
https://plaza.rakuten.co.jp/omegawatches89/...y/202208040002/
https://www.vingle.net/posts/4647033
https://penzu.com/p/576056fa
https://omegawatches89.simplesite.com/452938990
https://omegawatches89.simplesite.com/452939118
https://telegra.ph/Reasons-Why-You-Should-B...a-Watches-08-03

*




Кнопка "Транслит" перекодирует
текст из транслита в кирилицу.
Правила перекодировки здесь;
текст в квадратных скобках'[]'
не преобразуется.
Имя:

 преобразовывать смайлики · показать смайлики
Назначение кнопок:

   Поблагодарить автора сообщения — поблагодарить автора
   Удалить сообщение — удалить
   Редактировать сообщение — редактировать
   Поместить сообщение в колонку новостей — поместить в колонку новостей
   Цитировать — цитировать сообщение
   не входит в цитирование/входит в цитирование — цитировать несколько
   Отметить СПАМ-сообщение — обозначить спам
   Сообщение для модератора — связь с модератором
   Участник онлайн!/Участник оффлайн! — автор онлайн/оффлайн
   Фотография — фотография автора

   - остальные обозначения -
 
   *
« Предыдущая тема · Молекулярная и клеточная биология · Следующая тема »
Быстрый ответДобавить сообщение в темуСоздать новую тему

Rambler   molbiol.ru - методы, информация и программы для молекулярных биологов              

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Ваш форум  ·  redactor@molbiol.ru  ·  реклама  ·  Дата и время: 15.07.24 11:17
Bridged By IpbWiki: Integration Of Invision Power Board and MediaWiki © GlobalSoft