Rambler's Top100
Лёгкая версия форума* Виртуальная клавиатура  English  
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы
Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда | Междисциплинарный биологический онлайн-журналZbio-wiki

NG SEQUENCING · ЖИЗНЬ РАСТЕНИЙ · БИОХИМИЯ · ГОРОДСКИЕ КОМАРЫ · А.А.ЛЮБИЩЕВ · ЗООМУЗЕЙ


Темы за 24 часа  [ Вход* | Регистрация* ]  
   



Форум: 
 

Щёлкните, чтобы внести в Избранные Темы* Коммерческий биотерроризм -- Делитесь своими примерами --
Кураторы темы:* Asterix
Операции: Хочу стать куратором* · Подписаться на тему* · Отправить страницу по e-mail · Версия для печати*
Внешний вид:* Схема · [ Стандартный ] · +Перв.сообщ.


страницы (27): < 1 2 3 4 5 > »  
Добавить сообщение в темуСоздать новую темуСоздать голосование
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 18.02.2020 03:42     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Новости с фронтов коммерческого биотерроризма . Не так страшен черт как его малюют , но дорог собака .. ох как дорог.. Много бы эта круизная компания отдала чтоб не попасть в такую вот ситуацию. Ну с гарантией чтоб не попасть...

///16 февраля сообщалось, что общее число зараженных коронавирусом пассажиров и членов экипажа на лайнере достигло 355. Власти приняли решение снять с борта пожилых пассажиров, остальные же должны оставаться на судне до окончания 14-дневного карантина.

Круизный лайнер Diamond Princess встал на якорь у берегов Японии 5 февраля. Это произошло после того, как на его борту обнаружились люди с симптомами коронавируса. Разносчиком инфекции стал 80-летний житель Гонконга, сошедший на берег 25 января. Сейчас на корабле находятся около 3,7 тысячи пассажиров более чем из 50 стран.
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 18.02.2020 15:55     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

...ничерта Вы в бизнесе не понимаете.. Да компания счастлива - такая реклама!


...да уж. Сколько дней во всех склонениях.

...А представьте себе если там вдобавок к коронавирусу разразится эпидемия диарреи? Ну тут точно компания озолотится на бесплатной рекламе. .. И ведь это несложно сделать... рассказать как?
Участник оффлайн! banned sceptique-NMRguy
Постоянный участник
временной жизни



 прочитанное сообщение 19.02.2020 10:56     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Иди своему другу тертьякову это расскажи, если он на себе решит опробовать - форум несколько дополнительных дней без его поноса поживёт спокойно.

Всего благодарностей: 1Поблагодарили (1): Bear
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 19.02.2020 16:04     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Feb 19 at 1:00pm
Marburg and Ebola in Russian research center Vector

смерти ученых-вирусологов в центре "Вектор"

"Для спасения Антонины были предприняты титанические усилия

Ученые всего мира пытаются создать вакцину против Covid-19 — нового коронавируса, который сейчас бушует в Китае. Работают самоотверженно, как и раньше, когда искали противоядие от геморрагической лихорадки Эбола и Марбург. Цена научных прорывов была порой слишком большой. Некоторые из вирусологов и лаборантов расплатились за это своими жизнями.

Так, в 1988 году погиб сотрудник Всесоюзного научно-исследовательского института молекулярной биологии (ныне Государственный научный центр вирусологии и биотехнологии «Вектор») Николай Устинов. Неопытный лаборант во время забора крови у морской свинки случайно оцарапал ему иголкой от шприца палец. Концентрация вируса Марбург, попавшая в кровь, в несколько раз превышала любые допустимые нормы. В 2004 году заразилась вирусом лихорадки Эбола старшая лаборантка «Вектора» Антонина Преснякова. Она поранила руку во время уборки вивария. Со своими родными она прощалась через затемненное окошко инфекционного изолятора.

О своих коллегах, талантливых исследователях, кто положил жизнь и здоровье на алтарь науки, рассказал «МК» доктор биологических наук, профессор-вирусолог Александр Чепурнов, который заведовал лабораторией особо опасных инфекций в научном центре «Вектор», а сейчас работает в Институте экспериментальной клинической медицины СО РАН.

— Вы с Николаем Устиновым вместе начинали работать на «Векторе»?

— Мы одновременно пришли работать во Всесоюзный научно-исследовательский институт молекулярной биологии, как тогда назывался «Вектор». До этого Николай Устинов работал в Научно-производственном объединении в Томске, которое производило вакцину против клещевого энцефалита и иммуноглобулины. Там он сформировался как вирусолог. Я же занимался ботаникой, получил кандидатскую степень и решил попробовать свои силы в несколько иной области. Поскольку был дефицит кадров, институт развивался, создавались перспективные лаборатории, руководство решило, что вирусологов все равно никто не готовит, а биолога можно всему научить.

Нас отправили на трехмесячные курсы в Иркутский научно-исследовательский противочумный институт Сибири и Дальнего Востока. За группой был закреплен инструктор, который наблюдал, как мы работали с культурами микробов. Не должно было быть никаких ошибок, никаких случайных действий или неправильных телодвижений, так как любая капля, упавшая не туда, — это лабораторная авария. Начинали работать с банальными микроорганизмами пневмококка, а потом уже с опасными культурами: туляремией, холерой и бактериями чумы. Был очень серьезный контроль. Смотрели, в частности, есть ли у нас тремор в руках, обращали внимание на психологическую устойчивость. По окончании курсов инструктор давал заключение — способен человек к такой работе или нет. Мы с Николаем Устиновым получили необходимые документы.

После учебы его назначили руководителем отдела по наработке вирусов. Мне предложили создать лабораторию инструментального контроля отдела биологической безопасности. Возбудители не должны были проникнуть во внешнюю среду.

— Это был секретный объект?

— Институт позиционировал себя как открытое научное учреждение. Хотя проверка при приеме на работу была весьма серьезная. Документы оформлялись от полугода до года.

Когда мы пришли работать в институт, там только думали приступить к работе с наиболее тяжелыми инфекциями. Но то, как все было устроено в плане безопасности, впечатляло! Чего стоили одни каскады фильтров, которые занимали огромную комнату с потолками высотой пять метров. Внутри «грязной» зоны всегда было небольшое отрицательное давление. В случае разгерметизации оно не позволило бы выйти гипотетическому аэрозолю наружу.

Что касается жидких отходов, то они собирались сначала в емкости в изолированных боксах, проходили дезинфекцию в течение нескольких часов, а то и на протяжении всей ночи. Потом попадали в огромные накопительные емкости по 16 кубов, которые располагались в подвале. И следом проходили через змеевик, куда подавался перегретый пар температурой около 160 градусов.

— В виде чего хранились в институте опасные патогены?

— Мы работали с вирусами Эбола, Марбург, Венесуэльский энцефаломиелит лошадей и другими. Специальные емкости находились в низкотемпературных хранилищах. Выбор емкости зависел от количества материала. Например, когда забирали печень обезьяны, которая погибла от заражения вирусом Марбург или Эбола, то в ряде случаев использовали и обычные стеклянные банки, поскольку других, пластиковых, тогда не было. Но чаще в ходу были пенициллиновые флаконы, которые мы закрывали черными резиновыми лабораторными пробками. Их помещали в специальные герметичные металлические контейнеры, герметизировали, опечатывали и помещали в низкотемпературные холодильники. Они хранились при температуре -70, -80 градусов.

— Что такое «чистая» и «грязная» зоны?

— «Чистая» — та, где работали с документами, готовили посуду, проводили работы с неинфицированной культурой клеток и так далее. «Грязная» зона — где работали собственно с возбудителем, заражали культуры клеток, собирали урожай вируса, проводили всевозможные эксперименты, заражали животных, лечили их от вируса, вскрывали, работали с органами. Ее делили на 2 и 3 зоны. Во второй зоне проводилась работа с относительно невысокой степенью защиты. Надевалась пижама, маска-«лепесток», перчатки. Но все работы проводились в изолирующем боксе, вовнутрь мы вдевали руки в большие перчатки. Так и работали. Из-за вытянутой формы мы прозвали перчаточный бокс «крокодилом».

Особое внимание уделялось инфекционному виварию, за пределы которого внутри комнаты мог гипотетически выйти вирус. Еще одним «тревожным» местом была центрифужная комната, поскольку если в центрифуге что-то вдруг разбивалось или каким-то образом разгерметизировалась емкость, то создавалось облако аэрозоля. Поэтому работать там разрешалось только в изолирующих пневмокостюмах «Антибелок-5». Это обрезиненный костюм, который включал в себя собранные воедино бахилы, штанины, рукава и капюшон с пластиковой сферой для обзора. На штанинах был клапан для стравливания воздуха.

Помещения с такими условиями соответствовали 3-й зоне. В этой зоне на окнах устанавливались третье, дополнительное стекло, еще одна стена и дополнительный каскад фильтров. Герметичность «грязной» зоны (окна, стены, полы) регулярно проверялась. Войти в нее можно было через тамбур с двумя гермодверями.

— Что собой представлял виварий?

— В садках, которые помещались в металлические шкафы со стеклянными дверцами, содержались животные. Крыс я не держал, могли укусить. Работал в основном с морскими свинками, кроликами и обезьянами — либо с зелеными мартышками, либо с макакой резус. Для работы с вирусом Эбола наиболее подходили павианы — гамадрилы, только надо было подбирать не очень крупных животных. Бывало, что обезьяны у нас сбегали, они носились по верхам шкафов и воздуховодам, и поймать их, тем более в костюмах, это был тот еще квест.

Ученый-вирусолог Николай Устинов.

«Насчитали порядка тысячи и более летальных доз»

— Сотрудники, работающие с инфекциями, на самом деле должны были жить в городке-спутнике института Кольцово и не имели права выезжать за пределы поселка, не пройдя карантин...

— Отмечу, что работать с возбудителями, передающимися от человека к человеку, могли только сотрудники, постоянно проживающие в Кольцово. Выезд на срок более суток без прохождения карантина (21 день) не разрешался.

Существовало такое понятие, как обсервационный период. Это сложилось еще в тридцатых годах, когда один из сотрудников Саратовского противочумного института, заразившись и не заметив этого, уехал в командировку в Москву. Через несколько дней у него начали проявляться признаки болезни. Это привело к тому, что и он, и врачи, которые были привлечены к лечению, не сразу распознали чуму и погибли. Это было еще до открытия антибиотиков. После этого было принято решение о карантине для сотрудников, которые работают с заразными возбудителями.
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 19.02.2020 16:05     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Вы жили с Николаем Устиновым по соседству; общались вне работы?

— Когда в Кольцово сдали новый дом, мы оба получили в нем квартиры. Жили в соседних подъездах. У Николая был уже значительный опыт работы с Марбургом, а я в руках этот вирус не держал, работал ранее с нейротропными вирусами. Решил воспользоваться нашими добрыми отношениями и напросился к нему в ученики. Николай был очень отзывчивым и доброжелательным человеком, и я в течение трех недель сопровождал его при проведении работ, получил навыки работы с приматами. Потом уже вернулся в свой корпус, чтобы приступить к исследованиям. Когда появилась возможность работать с заразными возбудителями, я сосредоточился на изучении биологии вируса Эбола. Марбург и Эбола объединены в одно семейство. Оба характеризуются уровнем летальности от 30 до 90%.

Надо заметить, что Николай Устинов, как и большинство из нас, был чрезвычайно увлечен исследованиями, понятий «выходные» или «конец рабочего дня» для нас не существовало. Был кураж от ощущения, что стремительно нагоняем «партнеров».

— Как узнали, что Николай Устинов заразился?

— Когда был запущен новый корпус, пришло очень много молодежи. Николай Устинов не только выполнял функции руководителя направления, но и был для многих наставником. В тот день Николай работал с неопытным сотрудником. Они выполняли рутинную, но достаточно сложную в исполнении процедуру забора крови у морской свинки. Кровь у нее берется из сердца, и попасть в него достаточно сложно. Иглу надо ввести точно в сердце, не выше и не ниже, не глубже и не мельче. Николай обучал этой процедуре ассистента. И чтобы тому было удобнее, подставил руку под животное. Неопытный сотрудник, пытаясь нащупать сердце свинки, прошел насквозь иглой животное и попал в основание мизинца своего учителя. Костюм надежно защищал вирусологов, слабым местом были резиновые перчатки, даже двойные. Заменить резину другим материалом было невозможно. Ученые должны были чувствовать пальцами предмет, которого касаются. После аварии Николай Устинов с ассистентом, согласно нормативам, сразу же свернули все манипуляции, прошли дезобработку, вышли в «чистую» зону.

— Что собой представлял инфекционный стационар, который располагался на территории «Вектора», куда поместили Николая Устинова? Кто имел туда доступ?

— Там также были «чистая» и «грязная» зоны. В «грязной» зоне были боксы, где все было устроено так, чтобы предотвратить возможный выход возбудителя в окружающую среду. Он имел максимальную степень биологической защиты. Внутри бокса стояли кровать, были душ, унитаз, все необходимые средства для проведения интенсивной терапии. Николай попал под надзор врачей. Дальше был отбор проб, анамнез и прочие врачебные манипуляции.

— Была надежда на положительный исход?

— Поскольку не было движения поршня шприца, не было введения суспензии, оставалась надежда, что при прохождении через внешний кожный покров свинки иголка очистилась и полученная доза могла быть очень маленькой. Мы провели эксперимент, пытаясь выяснить, сколько могло быть возбудителя при таких работах на срезе иглы. И насчитали очень высокую дозу — порядка тысячи и более летальных доз.

Дальше потекли страшные дни ожидания. На четвертый день появились признаки заболевания. Болезнь развивалась, и никакими средствами из использованных, в том числе введением иммуноглобулинов, которые привезли, правда, поздновато (они эффективны в первые сутки и даже часы), ее нельзя было остановить. У Николая резко поднялась температура, возникли боли в мышцах, рвота, диарея и коагуляционные нарушения с кровотечениями. А потом наступила стадия геморрагий, когда кровь продолжала течь не свертываясь… Через неделю Николая не стало. Ему было 44 года.

— При лечении Николая Устинова и впоследствии, при вскрытии его тела, заразились врач и патологоанатом, который случайно поцарапался иглой шприца, которым брал у покойного образцы костного мозга. Как сложилась их судьба?

— Действительно, у реаниматолога из Министерства здравоохранения (жаль, не помню его имени) была шприцевая травма. Его поместили в соседней палате и ввели гаммаглобулин. У него наблюдали то ли абортивную, самопрервавшуюся форму течения болезни, что характерно для Марбурга при передаче от человека к человеку, то ли реакцию на чужеродный (лошадиный) глобулин. Но все обошлось, вскоре он вернулся к лечению Николая Устинова. Также получил травму при вскрытии один из ведущих специалистов института Олег Костырев. Ему был тоже введен глобулин, он подвергся карантину и, к счастью, вскоре поправился.

— Это правда, что Николай Устинов изучал возможность применения вируса в военных целях?

— В этой области знаний все исследования имеют и медицинский, и оборонный смысл.

— Ученым предназначалась какая-то страховка?

— Никто нас не страховал, но существовала очень солидная по тем временам ежемесячная доплата всем, кто работал с особо опасными инфекциями.

Перчаточный бокс, который ученые называют «крокодилом».

«Промахнулась и уколола руку»

— В 1990 году вирусом Марбург, «родственником» Эболы, заразился младший научный сотрудник «Вектора» Сергей Визунов. Что помогло ему победить болезнь?

— Этот случай очень необычный. Сергей Визунов, который проводил исследования с вирусом Марбург, был изначально госпитализирован в инфекционный стационар с признаками простуды. На этот счет есть инструкция. В случае повышения температуры всех, кто работал с вирусами Марбург или Эбола, направляли на обследование.

Ситуация несколько дней не вызывала никакого беспокойства, а диагностика для этой болезни еще не была разработана. Тем не менее у больного были взяты кровь и носоглоточные смывы и введены восприимчивым животным. На шестой день морские свинки начали болеть и погибать. Да и у Сергея Визунова температура потихоньку подкралась к 38 градусам. Стало понятно, что очень нехарактерно и медленно развивается болезнь Марбург, очевидно, вследствие необычного пути заражения — предположительно через слизистую глаз. Работая с сывороткой крови лабораторного животного, зараженного вирусом, и считая этот материал утратившим инфекционность, он, возможно, случайно задел пальцем глаза.

Болезнь брала свое, через пару недель на фоне высочайшей температуры и тяжелейшего состояния больной практически оказался при смерти, несмотря на применение всех возможных средств. Спасением неожиданно стала процедура плазмофереза — забор крови, ее очистка и возвращение обратно в кровоток. После этого у Сергея резко спала температура, произошло улучшение всех показателей. Но ненадолго. Процедуру повторили. И, казалось бы, больной пошел на поправку. Через месяц уже заговорили о выписке, но тут Сергея Визунова накрыла вторая волна болезни, и все началось сначала. В целом в стационаре он провел полгода.

— Трагедией для всех стала смерть 46-летней опытной старшей лаборантки Антонины Пресняковой...

— Она проработала в нашем институте много лет. Была нашей телезвездой. Когда в институт приезжали зарубежные или отечественные тележурналисты, именно она в специальном костюме производила определенные манипуляции с животными в виварии или в «крокодиле», чтобы гости могли понять специфику нашей работы. Я запомнил, как однажды кто-то из корреспондентов ее спросил: «Вы не боитесь, ведь смерть, опасные вирусы всегда рядом?» Антонина, не раздумывая, ответила: «Не надо бояться, надо работать».

Мы с ней и ее командой неоднократно пересекались по работе. Я по-доброму завидовал их слаженности и умению. И подумывал, как бы мне переманить их в мою лабораторию. Когда их лаборатория распалась, они начали работать под моим началом. В целом у нас собралась очень квалифицированная команда, но Тоня, пожалуй, была самой умелой из всех. В тот роковой день, 5 мая 2004 года, по этой причине именно ее попросили помочь отобрать кровь из сердца у морской свинки. Она взяла шприц, которым уже пробовали совершить эту манипуляцию, но, поняв, что игла затромбирована (в ней свернулась кровь, и она стала непроходимой), положила его в емкость с дезраствором — хлорамином. Взяла новый шприц, забрала кровь и отдала ее в работу. А сама начала приводить в порядок рабочее место. Убрала животных, замочила в хлорамине шприц, которым работала. И, чуть помешкав, решила закрыть защитным колпачком затромбированный шприц. Достала его из дезраствора и, вдевая иглу, промахнулась, уколола руку. Ее поместили в изолятор.

— Шприц, которым укололась Антонина, побывал ведь в хлорамине. Беды не ждали?

— Мы вообще не ожидали, что она заболеет. В первые дни меня к ней пускали. Инкубационный период составил 7 дней. На седьмой день утром температура была 37.2, у Антонины появилось першение в горле. А первым характерным признаком лихорадки Эбола как раз и является затруднение при глотании. Потом мне позвонили и сказали, что у нее поднялась температура до 39 градусов, Тоню перевели в бокс интенсивной терапии, и началась борьба за жизнь.

Я привел на территорию института, к стационару, детей Антонины, сына и дочь. Мы подошли к окну так, чтобы она могла их видеть. Она еще двигалась, выглядела неплохо. Там на окнах была наклеена специальная пленка. Тоня видела нас, а мы ее — плохо.

Все очень надеялись на плазмаферез. Но он не помог. Не помогло и введение иммуноглобулина. Для спасения Антонины были предприняты титанические усилия. Наши медики даже связывались с врачом в Африке, через которого прошли сотни больных вирусом Эбола. По его рекомендации применили все возможные средства. Но силы ее таяли. Это очень мучительная, страшная болезнь, с множественными наружными и внутренними кровоизлияниями.

На 7-й день Антонине стало легче, врачам казалось, что произошел перелом, все воспряли духом. Я не разделял их эйфории. Через мои руки прошло много инфицированных приматов, я опасался как раз этого момента. Потому что знал, что облегчение часто наступает перед очередным осложнением. И это может означать, что конец уже близок. И действительно, 19 мая в 5 утра мне позвонил руководитель «Вектора» Лев Сандахчиев и сказал, что Антонина умерла. И попросил сообщить об этом ее близким. Пожалуй, это был самый тяжелый момент в моей жизни. Тоня умерла в тот день, когда ее сыну исполнилось 18 лет.

— Говорят, что Антонину Преснякову хоронили в закрытом цинковом гробу, а тело, чтобы исключить распространение вируса, обработали специальными препаратами, которые якобы составляли государственную тайну.

— Никаких там специальных и секретных технологий не было. Пришли двое сотрудников, обработали бокс. Один из них завернул тело Антонины в некий саван, в простыни, которые были пропитаны дезинфектантами — противомикробными веществами. Положили Тоню в обычный гроб, который поместили в саркофаг, цинковый гроб, и запаяли его. Потом у нас заговорили о мистике. Тот, кто оборачивал тело Антонины в простыни, на следующий день после похорон погиб в автокатастрофе. Смерть Антонины стала для всех нас большой утратой. Поскольку все испытывали сильный стресс, я опасался, что одно неосторожное движение может привести к новой трагедии. И администрация пошла на то, чтобы пригласить для сотрудников нашей лаборатории психолога.

— Память о погибших сотрудниках как-то увековечена?

— Нет, к сожалению, никаких барельефов им не сделано и памятных досок не открыто. 19 мая, в день смерти Антонины Пресняковой, мы приходим на ее могилу на Кольцовское кладбище. Собирается ее семья и мы — всей лабораторией. А потом идем поклониться Николаю Устинову.
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 19.02.2020 18:56     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Рекомендую , там между строк намек на то что произошло в Китае...
/////////////////
— Память о погибших сотрудниках как-то увековечена?

— Нет, к сожалению, никаких барельефов им не сделано и памятных досок не открыто. 19 мая, в день смерти Антонины Пресняковой, мы приходим на ее могилу на Кольцовское кладбище. Собирается ее семья и мы — всей лабораторией. А потом идем поклониться Николаю Устинову.

ref https://www.mk.ru/social/health/2020/02/18/...tre-vektor.html
Участник оффлайн! CowDoc
Постоянный участник
Middle East



 прочитанное сообщение 20.02.2020 10:20     Сообщение для модератора  Сообщение для куратора темы       Фотография  Личное письмо  Отправить e-mail

(Asterix @ 19.02.2020 18:56)
Ссылка на исходное сообщение  
Память о погибших сотрудниках как-то увековечена?

А >сотни погибших после выхлопа в Свердловске-19, кто-то вспоминает, кроме параноика в погонах ...?
А в Загорске-6?
А в том же Саратове? Аральске? Кирове, пр., что, не было?
Память Николая Васильевича Устинова увековечена, в штамме "У" (U) Марбурга (не Эбола!!!) в честь него назван.

Гниды в погонах все секретят. Не наигрались. И штат их опять увеличивают везде )))

У нас уже новое поколение костюмов было, "Алики" мы их называли. Да, и "крокодилы" на фото какие-то мелкие. Тогда, когда "аэрозолями" занимались, то во всех НИИЧАВО закупали, от подобных, мелких, до огромных, чтобы зверушек туда посадить можно было.
Удивительно, что им фоткать разрешили. Хотя, после МНТЦешных проектов, все можно уже и не скрывать.

Сообщение было отредактировано CowDoc - 20.02.2020 10:53

Всего благодарностей: 1Поблагодарили (1): Asterix
Участник оффлайн! Panaev
Постоянный участник



 прочитанное сообщение 20.02.2020 13:03     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 19.02.2020 19:56)
Ссылка на исходное сообщение  Рекомендую ,  там между строк намек на то что произошло в Китае...
////////////

Какие-то китайцы тогда странные выходят.
Если принимать версию об утечке (я ничего не утверждаю, так как это практически недоказуемо), то получается, что китайцы создавали этноспецифический вирус, поражающий китайцев. Судя по тому, что его вирулентность и патогенность для европеоидов сильно ниже.
Просто гипотетические рассуждения.
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 20.02.2020 13:21     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Создавали его в Канаде, руководствуясь самой обычной логикой исследований и разработки вакцин. Это в рамках проекта по [SARS-MERS] Видимо скрининг шел на клеточных культурах.

А в Китай ауртсорсили работы на животных , что там существенно проще и дешевле чем на Западе.

Ну и вот , не ожидали даже такого... впрочем теперь видно что работа удалась на славу.

Какой там на самом деле штамм особо опасный мы скорее всего и не узнаем... Китайское правительство плотно занялось дымовой завесой... разбавляют число заболевших включая в них все что угодно ... лишь бы общую морталити удерживать ниже 2%. Простое административное решение, вполне китайское по-сути. Хотя конечно оно наметанному глазу заметно что все смерти концентрируются в одном месте .. а заболевшие диагностируются по всему Китаю, но почему-то не мрут.

Всего благодарностей: 1Поблагодарили (1): banned sceptique-NMRguy
Участник оффлайн! спин
Участник



 прочитанное сообщение 22.02.2020 16:23     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

В Корее зараженные Кор. вирусом (неск.чел) не контактировали с больными Кор-ом, но заболели. Вспоминаем Люка Монтанье и его гипот. идею, что вирусы могут распространяться квантовым путем. В опред. условиях. Что соответствует эксп. доказанному квант. переносу ДНК на макро расстояния. А также РНК, которая регистрируется как безматричный синтез РНК РНК зависимой РНК полимеразой фага Ку-бета.
_____________________________1_27_.pdf
размер: 1.17мб
кол-во скачиваний: 30
22.02.2020 — 23.08.2020


Central_Dogma.pdf
размер: 513к
кол-во скачиваний: 26
22.02.2020 — 23.08.2020

Участник оффлайн! LMP
Постоянный участник



 прочитанное сообщение 22.02.2020 18:30     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Не выходи в интернет, а то заразишься убогий
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 23.02.2020 00:08     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

https://www.youtube.com/watch?v=9P2vH8RK2qo

Я так понимаю из его презентации что эпидемиологичeская работа в России совершенно развалена и в силу этого даже если коронавирус и начнет бушевать в Москве , то ни метро ни прочий общественный транспорт никто закрывать не будет .. Просто не заметят и все ... ну кто знает что это ОРВИ и ОРВИ, грипп он и есть грипп. Ну а пенсионеры мрут - так Пенсионному Фонду легче .
Участник оффлайн! ИНО
Постоянный участник
Донецк



 прочитанное сообщение 23.02.2020 01:13     Сообщение для модератора  Сообщение для куратора темы       Личное письмо

Просрали все полимеры, пора накрываться простыней и отползать в сторону кладбища.

Всего благодарностей: 1Поблагодарили (1): banned sceptique-NMRguy
Участник оффлайн! banned sceptique-NMRguy
Постоянный участник
временной жизни



 прочитанное сообщение 23.02.2020 12:20     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 20.02.2020 14:21)
Ссылка на исходное сообщение  Создавали его в Канаде, руководствуясь самой обычной логикой  исследований  и разработки вакцин.  Это в рамках проекта по [SARS-MERS] Видимо  скрининг шел на клеточных культурах.

А в Китай ауртсорсили работы на животных , что там существенно проще и дешевле чем  на Западе.

Ну и вот , не ожидали даже  такого...  впрочем  теперь видно  что работа удалась на славу.

Какой там на самом деле штамм особо опасный  мы скорее всего и не узнаем...  Китайское правительство плотно занялось дымовой завесой... разбавляют число заболевших  включая в них все что угодно ... лишь бы общую морталити удерживать  ниже 2%. Простое административное решение,  вполне китайское по-сути.  Хотя конечно оно наметанному глазу заметно  что все смерти  концентрируются в одном месте .. а заболевшие диагностируются по всему Китаю, но почему-то не мрут.

Вот видно же, что ещё можете, когда хотите. Хватит гнать пургу и злоупотреблять веществами, Вас адекватного интереснее читать чем всякие Ваши бредки когда Вы под воздействием... umnik.gif
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 23.02.2020 16:19     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Ну и так уже на 5 разведок работаю ... еще и на вас угождать... уж что есть то есть , здесь я развлекаюсь, отвлекаюсь от работы. рефлексирую , шучу , прикалываюсь...
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 23.02.2020 16:21     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Американский Zipline доставляет медикаменты на дронах вдали от больших городов. Пациент попадает в местную больницу или фельдшерский пункт, для лечения чего-то не хватает, врач пишет или звонит в Zipline, со склада вылетает дрон. Он долетает до места, сбрасывает товар и возвращается на базу. От вызова до доставки проходит пара часов.

Дальность полета дрона – 160 километров, но ему ещё вернуться надо, т. е. реальный радиус покрытия – 80. В итоге один дистрибьюторский центр покрывает примерно 20 тысяч квадратных километров, на Московскую область их потребовалось бы три, на Германию двадцать. В реальной Руанде их два. Грузоподъёмность дрона меньше двух килограммов. Для лекарств или донорской крови , ваккцин и прочих надобностей медицины катастроф и поддержки военно-полицейских экспедиций и охраны добывающей полезные ископаемые инфраструктуры этого достаточноно.

Zipline активно работает в двух африканских странах, Гане и Руанде, с суммарным населением 40 миллионов человек. Проводятся эксперименты в Индии и даже США. Пиар хвастается 30 тысячами совершенных доставок за всю историю компании. Само по себе это очень маленькое число: в пересчете на привлеченные инвестиции получается, что за каждый вылет инвесторы по 7 тысяч долларов заплатили. И почему-то среди них царит оптимизм... что-то тут не то чем оно кажется.

//////////////

Ну вставлю 5 копеек, конечно же этот проект в Африке некоммерческиой в принципе, и задача там красиво пилить бабло занимаясь вот футуристическим делом... И инвесторы совершенно не в убытке, несмотря на астрономические накладные расходы.. Подобные схемы в Африканских странах обычное дело... кто-то за все это таки платит из какого-то бюджета или еще как... Там денег-то полно, просто они до населения не доходят, оседают в карманах ограниченного круга лиц которые тоже любить вот переизбираться и хвастаться своей прогрессивностью.

Сама по себе доставка товаров на дронах - это вполне себе бизнес ... так же как и применение дронов в геологоразведке, в сельском хозяйстве и прочее..

В Африке есть особенность , население дико суеверно ... и его надо приучать к этим дронам в небе ... как к чему-то безопасному и позитивному , ну типа доктор Айболит вот там летает и лечит зверушек...

Ну а чем там эти дроны на самом деле занимаются ... это населению лучше не знать.

Билл Гейтс вот с Мелиндой тоже немало заинтересованы в поголовной вакцинации африканского населения... тоже огромные деньги в это вбухивают. Чиновников даже подкупают чтоб пройти испытания и разрешения получить. И ведь успешно, успешно .

-а чем они на самом деле занимаются?

Скорее всего отрабатывают технологию контроля за территорией. Инфраструктуру для дронов создают. Дронам нужна привязка к местности , одного глобального позиционирования недостаточно.

В Африке вообще куча неведомых нам проблем, в основном ментального плана.
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 23.02.2020 21:36     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 22.02.2020 22:08)
Ссылка на исходное сообщение  https://www.youtube.com/watch?v=9P2vH8RK2qo

Я так понимаю из его презентации что эпидемиологичeская работа в России совершенно развалена  и  в силу этого даже если коронавирус и начнет бушевать в Москве   , то ни метро  ни прочий общественный транспорт  никто закрывать не будет   .. Просто не заметят  и все ... ну кто знает что это  ОРВИ и ОРВИ, грипп он и есть грипп.  Ну а пенсионеры мрут  - так Пенсионному Фонду легче .

она, конечно, развалена. но ситуация медленно выправляется. слишком медленно, но общая динамика положительная. я бы сказал, что идет смена менталитета на уровне смены поколения. просто поколение санэпиднадзора, рожденное в ссср было неспособно работать в новых условиях, когда люди не строятся в колонну по одному для вакцинации или там дезинфекции.
но по сравнению с тем, что было еще лет десять назад, стало лучше. и даже какой-никакой мониторинг за воздушнокапельными в режиме реального времен есть. правда лабораторную дифдиагностику проводят только уже госпитализированным, амбулаторные ее не получают. но и это уже движение вперед . десять лет назад и этого не было.
кстати, чувак так себе. у меня зубы заболели, когда он путал антитела и антиген, нес какуюто дичь про злобные фармкомпании, готовые запатентовать последовательности этого вируса...

Сообщение было отредактировано vb - 24.02.2020 02:51

Всего благодарностей: 1Поблагодарили (1): banned sceptique-NMRguy
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 24.02.2020 02:48     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(ИНО @ 22.02.2020 23:13)
Ссылка на исходное сообщение  Просрали все полимеры, пора накрываться простыней и отползать в сторону кладбища.

не ссать, прорвемся. вообще не вижу повода для уныния. мне кажется, нашим дедам расскажи - они удивятся чего мы переживаем.

Всего благодарностей: 3Поблагодарили (3): Vorona, Vadim Sharov, banned sceptique-NMRguy
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 24.02.2020 14:15     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

дичь про злобные фармкомпании, готовые запатентовать последовательности этого вируса...

Ну вот этои как раз реальность нашего времени.. Я вот тоже фигею что творится в области каннабиса , патентуют не просто дикие клонированные гены после подтверждения их функции, а еще и вставляют в патент таблицу генетического кода и пишут что все синтетические версии версии этого гена с гомологичными заменами ведущими к разнице в последовательности аминокислот белка менее 85% тоже защищены патентом. И еще таблицу замен аминокислот вставляют, типа что считать незначимыми заменами, ну например лейцин-изолейцин.. итд...

Глаза на лоб лезут как такие патенты читаешь... охренеть.
Участник оффлайн! ИНО
Постоянный участник
Донецк



 прочитанное сообщение 24.02.2020 14:46     Сообщение для модератора  Сообщение для куратора темы       Личное письмо

Я-то не ссу, я ржу с поста Астерикса, о грядущем эпидемиологическом апокалипсисе в РФ.
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 24.02.2020 18:22     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 24.02.2020 12:15)
Ссылка на исходное сообщение  дичь про злобные фармкомпании, готовые запатентовать последовательности этого вируса...

Ну вот этои как раз  реальность нашего времени..  Я вот тоже фигею  что творится в области  каннабиса , патентуют  не просто дикие  клонированные гены  после подтверждения их функции,  а еще и вставляют в патент таблицу генетического кода  и  пишут  что все синтетические версии  версии  этого гена  с  гомологичными заменами  ведущими  к  разнице в последовательности  аминокислот  белка менее 85% тоже  защищены  патентом.  И еще таблицу замен аминокислот вставляют, типа что считать незначимыми заменами, ну например лейцин-изолейцин..  итд...

Глаза на лоб лезут как такие патенты читаешь... охренеть.

ну хз. я, конечно, не спец в патентовании, но когда несколько лет назад залез в эту область наткнулся прям на ограничения, прописанные в явном виде - нельзя патентовать дикие последовательности. оптимизированные, кстати, можно, тем более с заменами.
ну даже, если и проскочит где такой патент - замучаются охранять его.
Участник оффлайн! banned sceptique-NMRguy
Постоянный участник
временной жизни



 прочитанное сообщение 24.02.2020 19:29     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 24.02.2020 15:15)
Ссылка на исходное сообщение  дичь про злобные фармкомпании, готовые запатентовать последовательности этого вируса...

Ну вот этои как раз  реальность нашего времени..  Я вот тоже фигею  что творится в области  каннабиса , патентуют  не просто дикие  клонированные гены  после подтверждения их функции,  а еще и вставляют в патент таблицу генетического кода  и  пишут  что все синтетические версии  версии  этого гена   с   гомологичными заменами  ведущими  к  разнице в последовательности  аминокислот  белка менее 85% тоже  защищены  патентом.  И еще таблицу замен аминокислот вставляют, типа что считать незначимыми заменами, ну например лейцин-изолейцин..  итд...

Глаза на лоб лезут как такие патенты читаешь... охренеть.

Чем больше таких патентов будет, тем легче будет иллюстрировать несведущим полное безумие самой идеи так называемого "патентного права". Вот в Китае оно как бы декларировано, но по факту его нет, так как если государство (вероятно, все госслужащие вместе взятые) решит его нарушить по стратегическим соображениям, то - можно нарушать и как угодно.

Сообщение было отредактировано banned sceptique-NMRguy - 24.02.2020 19:30
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 28.02.2020 03:22     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Вобще уже пора предлагать к продаже сыворотку крови успешно переболевших.. дорого конечно , но зато 100% еффективность. Можно даже старт-ап забацать на этом. Ну немного нелегальный конечно , там с кровью очень много регуляций есть, не так просто устроить легальное переливание сыворотки по такому поводу как защита от вирусной инфекции.
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 28.02.2020 03:23     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

рекомендую литературу по теме от 2006 года .. От моего хорошего знакомого Браяна... Он отлично соображает , и при том совершенно непопулярен у себя в Штатах... Мы с ним очень похожи.

This chapter covers history of biological events impacting war, bioterrorism, and biological warfare preparations.
We contextualize ordinary warfare versus infectious disease in the past century, showing that infectious disease has considerably higher casualties - All 20th century wars combined killed no more than 5% of the death toll from infections disease.
We cover the 7 principles of biological warfare, and then discuss possible attackers using historical precedent and the logic of international realpolitik.
We discuss motive and organization of attackers in a modern context, and how attackers can protect themselves from their own attack.
We provide 3 scenarios for biological warfare, in a modern context, with a short discussion of how terrorism really operates.
We cover types of biological weapons (not exhaustively), and the strateg involved in biological warfare.

We close with biodefense methods and logistics fundamentals, and conclude with principles of biodefense.

1. Support for public health so diseases are visible as rapidly as possible. Currently, illegal aliens and the poor are major vectors for infectious diease.
2. Human intelligence is irreplaceable in bioterrorism defense. We discuss the most difficult aspect, religious organizations, that have been the sole historical source of biological attacks and attempts.
3. Back development of low-cost consumer use disease diagnostics.
4. Clear the way legally for use of excess blood serum for ongoing survey and analysis of contagious disease.
5. Make improvements to vaccine development for emergencies, clearing regulatory, financial and technical hurdles.
and more....

https://www.researchgate.net/publication/20...aces_and_Cities

Всего благодарностей: 1Поблагодарили (1): Bear
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение Сообщение на английском  28.02.2020 03:28     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

We should all remember that disease has shaped the world already. The conquest of North America and South America by Europeans was built on disease that killed 95% and more of the native peoples.
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 28.02.2020 08:58     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 28.02.2020 01:22)
Ссылка на исходное сообщение  Вобще уже пора предлагать  к продаже  сыворотку крови  успешно переболевших.. дорого конечно , но зато 100%  еффективность.  Можно даже старт-ап забацать на этом.  Ну немного нелегальный конечно , там с кровью очень много регуляций есть, не так просто  устроить легальное переливание сыворотки  по такому поводу как защита от вирусной инфекции.

поздравляю вас, вы изобрели специфические сыворотки, а если немного напряжетесь, то изобретете специфические имунолгобулины...
правда, где-то я уже об этом слышал, помню даже нобелевку комуто давали...

Всего благодарностей: 1Поблагодарили (1): Asterix
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 28.02.2020 14:13     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Ну и, кстати, кто-то пытался найти в России место, где можно пройти тест на китайский коронавирус? Вигвам. Нет его, места такого.

Irina Ermolaeva Я читала, что его делают только в Новосибирском Векторе. Все анализы туда посылают. Ответы только в Роспотребнадзоре. Даже врачам, где лежат люди на карантине результатов не говорят. Поэтому в ежедневном докладе ВОЗ у нас устойчиво 2 заболевших и ни одного заразившегося уже много дней.

Олег Волков Irina Ermolaeva, когда-нибудь мы узнаем, кому и для чего была нужна эта фейковая эпидемия. Судите сами, из 2000 пассажиров и экипажа круизного лайнера умерли только двое 80-летних старика. Остальные заразившиеся выздоровели. И это при общей системе вентиляции. И это только один странный факт.
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 28.02.2020 14:20     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Чтобы увидеть что там ждет впереди, надо обернуться назад....Вирус гриппа, 1918, Петропавловская больница Петрограда - 245 больных с испанкой поступило - смертность 10%. Значит 24-25 человек ( Красная газета 1918, 17 октября). В январе эпидемия уже закончилась. За тот же год 4305 смертей от холеры при общем количестве зараженных около 12 тысяч человек. Тиф, 1918, только в городскую инфекционную больницу поступает 6000 человек, что больше чем за все 36 предыдущих лет вместе взятые. 1919 год - 36367 случаев сыпняка....за все годы своего изучения медицины я встречал разные цифры потерь от испанки. от 10 до 100 млн. человек. Вопросы 1. Кто и как считал? Лига наций создана позже. 2. Почему в описаниях мастеров тех лет от Ремарка до Пастернака не описаны эти поля трутов. А ведь потери от войны Франции и Англии в первой мировой 1,3 млн. и это очень много....теперь только представить эти 100 млн. трупов...Мне видится, что лига наций закрыла потери от всех инфекций, которая была много больше чем боевые потери пот цифрой испанки. Уж больна она похожа на сумму тифа+холеры+чумы+сифилиса+ туберкулеза.....
Участник оффлайн! Panaev
Постоянный участник



 прочитанное сообщение 28.02.2020 16:56     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 28.02.2020 15:20)
Ссылка на исходное сообщение  Чтобы увидеть что там ждет впереди, надо обернуться назад....Вирус гриппа, 1918, Петропавловская больница Петрограда - 245 больных с испанкой поступило - смертность 10%. Значит 24-25 человек ( Красная газета 1918, 17 октября). В январе эпидемия уже закончилась. За тот же год 4305 смертей от холеры при общем количестве зараженных около 12 тысяч человек. Тиф, 1918, только в городскую инфекционную больницу поступает 6000 человек, что больше чем за все 36 предыдущих лет вместе взятые. 1919 год - 36367 случаев сыпняка....за все годы своего изучения медицины я встречал разные цифры потерь от испанки. от 10 до 100 млн. человек. Вопросы 1. Кто и как считал? Лига наций создана позже. 2. Почему в описаниях мастеров тех лет от Ремарка до Пастернака не описаны эти поля трутов. А ведь потери от войны Франции и Англии в первой мировой 1,3 млн. и это очень много....теперь только представить эти 100 млн. трупов...Мне видится, что лига наций закрыла потери от всех инфекций, которая была много больше чем боевые потери пот цифрой испанки. Уж больна она похожа на сумму тифа+холеры+чумы+сифилиса+ туберкулеза.....

Да вся эта беготня с испанкой у меня тоже давно недоумение вызывает.
Кроме того, почему-то все замалчивают тот факт, что сопротивляемость организма огромных людских масс была снижена недоеданием, стрессами (войны, миграции, революции), снижением уровня гигиены... на этом фоне любая инфекция будет расцветать.

Может они теоретически потери в Азии посчитали? Хотя это уже вообще натяжки.

Сообщение было отредактировано Panaev - 28.02.2020 16:57
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 28.02.2020 18:08     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

А я бы себе бы ввел кубиков эдак 100 через капельницу... и запечатлел бы сие действие на видео ... а потом бы , тоже под камеру , в присутвии понятых ввел бы себе и этот вирус . ядреный и живой , не аттеньюированный...

И посидел бы в карантине у нас тут в госпитале ... и вел бы он-лайн репортажи из палаты каждый день.. О своем самочувствии. Ну немного бы конечно переигрывал .. Но что только не сделаешь ради бессовестного самопродвижения...

Ну я могу заказать праймеры специфичные и анализировать плевки сограждан на корона-вирус именно Уханьский а не какой другой. Копейки себестоимость-то, а брать можно по 100 евро за нализ запросто. Разбогател бы очень быстро. ...

Но как долго я смогу это делать? Без лицензии-то?
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 28.02.2020 21:19     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 28.02.2020 16:08)
Ссылка на исходное сообщение  А я бы себе бы ввел кубиков эдак 100  через капельницу... и запечатлел бы сие действие на видео ... а потом бы , тоже под камеру , в присутвии понятых  ввел бы себе и этот вирус  . ядреный и живой , не аттеньюированный... 

И посидел бы в карантине у нас тут в госпитале ...  и вел бы он-лайн репортажи  из палаты  каждый день..  О своем самочувствии.  Ну немного бы  конечно  переигрывал ..  Но что только не сделаешь ради  бессовестного самопродвижения...

Ну я могу заказать праймеры специфичные  и анализировать плевки сограждан на корона-вирус  именно Уханьский  а не какой другой. Копейки себестоимость-то, а брать можно по 100 евро  за нализ запросто. Разбогател бы  очень быстро. ...

Но как долго я смогу это делать?  Без лицензии-то?

ох уж мне эти товарищи ученыеб доценты с кандидатами...
а потом внезапно выясеится, что твои прамеры крестятся с десятком вирусов. испытания не просто так придумали, хоть будь у тебя пцр или рпга
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 29.02.2020 00:54     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Да сделаю три пары , это же некоммерческий диагностикум ... Ну и пусть крестятся с кем угодно , с тремя то парами по-любому будет отлично все видно. со 100% гарантией результата.
Участник оффлайн! Born5




 прочитанное сообщение 29.02.2020 00:58     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 29.02.2020 01:54)
Ссылка на исходное сообщение  Да сделаю три пары , это же некоммерческий диагностикум ...  Ну и пусть крестятся  с кем угодно ,  с тремя то парами  по-любому будет отлично все видно.  со 100% гарантией результата.

плотник пока ты сделаеш одну вирус помрет smile.gif
Участник оффлайн! Born5




 прочитанное сообщение 29.02.2020 01:23     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 29.02.2020 01:54)
Ссылка на исходное сообщение  Да сделаю три пары , это же некоммерческий диагностикум ...  Ну и пусть крестятся  с кем угодно ,  с тремя то парами  по-любому будет отлично все видно.  со 100% гарантией результата.

плотник маятся дурью сугубо личное дело wink.gif
Участник оффлайн! Born5




 прочитанное сообщение 29.02.2020 01:48     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 29.02.2020 01:54)
Ссылка на исходное сообщение  Да сделаю три пары , это же некоммерческий диагностикум ...  Ну и пусть крестятся  с кем угодно ,  с тремя то парами  по-любому будет отлично все видно.  со 100% гарантией результата.

плотник а чого только 3 пары давай уж 100 lol.gif lol.gif lol.gif
Участник оффлайн! Born5




 прочитанное сообщение 29.02.2020 02:06     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

плотник чиго замолк?
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 29.02.2020 02:13     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Что-то последние новости заставляют меня задуматься , а не затариться ли мне товарами из супермаркета.. Ну так , на всякий случай.

Вот вдруг какое нарушении логистики произойдет из-за этого вируса? У нас же запасов товаров в магазинах на 2 дня. Там мигом пустые полки будут. И у меня нет родственников в деревне тут , чтоб можно было бы хоть овощами там затариться если что.

Буду как дурак ходить по пустым магазинам с полным кошельком денег. вспомню молодость свою советскую. И не факт что на рынке будет еда ... совсем не факт.

taki kuplyu yawik spagetti...
Участник оффлайн! Begemotik
Участник



 прочитанное сообщение 29.02.2020 08:15     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 29.02.2020 00:13)
taki kuplyu yawik spagetti...
лучше корицу с лимоном для "Хот Тодди", говорят лучше иммуноглобулинов помогает
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение Сообщение на английском  04.03.2020 00:56     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Primer pair (Broadly Reactive)
IN-2 (+) 5'GGGTTGGGACTATCCTAAGTGTGA 3'
and IN-4 (–) 5'TAACACACAACICCATCATCA 3'

Previously designed to conserved regions of open reading frame 1b to achieve broad reactivity with the genus coronavirus. These primers were used to amplify DNA from SARS isolates, and the amplicon sequences obtained were used to design specific primers.
SARS-specific primers:
Cor-p-F2 (+) 5'CTAACATGCTTAGGATAATGG 3',
Cor-p-F3 (+) 5'GCCTCTCTTGTTCTTGCTCGC 3',
and Cor-p-R1 (–) 5'CAGGTAAGCGTAAAACTCATC 3',

Used in turn to test patient specimens. // I am going to order those broadly reactive pair and also my own designed specific primers , I also can do research. No RT-PCR , just old horse Bio-Rad T100, and agarose gel... Now it is the best time For Dr. Zayner to sell a Corona-Virus Kit, for DIY-Bio community. On the Hype ... SARS-CoV Specific PCR Primers for diagnostics.. WoW. Full genome is here , who wants to join me for exercise in PCR primer design? https://www.ncbi.nlm.nih.gov/nuccore/MN908947
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 04.03.2020 01:55     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Прекрасная рецензия на фильм Паразит. Именно - это классический восточный сюжет ... там такого добра завались , на любые вкусы . И не в сюжете дело... а в игре актеров этой старинной пьесы.. Именно они делают разницу в различных представлениях на публике.

///
я довольно много корейских фильмов и сериалов смотрю. И среди них примерно четверть с похожим сюжетом. Обычно, правда, действие перенесено в средневековые декорации. Молодой простолюдин/простолюдинка попадает в королевский дворец в качестве гвардейца/служанки/евнуха/мелкого чиновника и, выделяясь своими способностями, делает стремительную карьеру, нарушающую конфуцианские представления о субординации. Понимая что "правила игры" несправедливо ограничивают его/её продвижение к власти/богатству, герой/героиня начинает пользоваться слабостями и умственной ограниченностью вельмож, а потом и королевской четы, постепенно расставляя на все значимые позиции своих жадных и аморальных родичей-простолюдинов. Постепенно герой/героиня превосходит свой "уровень компетентности" и начинает зарываться. Растут противоречия и недовольство обойдённых конкурентов. В конце происходит катастрофа, уносящая жизни героя/героини, прихлебателей и большинства противостоящих им, вельмож и членов королевской семьи. Корейцы такое, видимо, любят. Европейской морали в этом сюжете обычно не видно.

Всего благодарностей: 1Поблагодарили (1): Bear
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 05.03.2020 22:39     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

А вот и актуальность , молбиольныхх обитателей могут и к годику приговорить за слишком вольные комментарии. Мотайте на ус.
///
Взрыв в управлении архангельского управления ФСБ, который комментировал осужденный, произошел в апреле 2018 года. Его устроил 17-летний студент политехнического техникума, объяснив поступок в Telegram-чате анархистов тем, что таким образом «выражает протест против фабрикации дел и пыток». В результате погиб сам исполнитель и пострадали три сотрудника спецслужбы. Следственный комитет признал случившееся терактом.

В июле прошлого года Самарский гарнизонный военный суд приговорил жителя Тольятти Александра Довыденкова к году колонии за твит, в котором содержались лингвистические признаки оправдания действий архангельского подростка. Правозащитники отмечали, что твит осужденного не собрал ни одного лайка и репоста.
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 12.03.2020 15:59     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Кстати , карантин мог бы стать вполне действенным средством при борьбе государства с массовыми народными волнениями политического характера. Достаточно сделать вброс инфекции , может быть даже и липовый и обьявить карантин , население напуганное предыдущими учениями покорно свернет несанкционированные сборища и будет сидеть по домам.

Удивительно даже , этому моему проекту уже лет 7 наверное , так и висит на ЛинкедИн там , хотя одно время был какой-то всплеск интереса ко мне со стороны странных лиц ... но прошел.. Зато вот реальность меня удивила.

/////

Widespread tests….

South Korea’s cases of infection had been minimal until the third week of February when cases suddenly exploded in the country’s southeast – a result of chain infections in crowded services held by the secretive Christian sect, Shincheonji.

Some 63% of Korea’s cases hail from the sect, according to government data.

While Shincheonji members are scattered nationwide, the government demanded – and received – its membership list. Contrary to widespread rumors and accusations, a senior government official said the church has cooperated.

“A lot of research has been conducted based on the information delivered by their HQ, it was very comprehensive info: the number of members, their personal information and the location of their church facilities,” said Vice Minister of Health and Welfare Kim Gang-lip, who is also overall coordinator 1 of the Central Safety Countermeasures Headquarters.

“The reliability of the information was verified through an administrative investigation,” Kim said. “We went into their information systems to verify and double check; from the overall organizational perspective, they are cooperating.”

The government implemented widespread testing of the church’s 211,000 followers. Those with symptoms were triaged as priority testees; once they were cleared, tests were conducted on those who showed no symptoms to ensure they were not latent carriers.

“From the containment phase, we tried to implement case isolation and case tracking, and this was done in a very aggressive manner,” Kim Dong-hyun of the Korean Society of Epidemiology said.

“We have legal grounds for cohort isolation,” said Kwon. “Rather than being an infringement of human rights, this was for the prevention of epidemic.” Related laws on the books date back to the MERS outbreak and further legal changes take effect in April.

Case tracking was done via CCTV data mining and credit use patterns.
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 12.03.2020 16:20     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Кстати про пустые полки в магазинах , в этом есть вполне конкретный смысл, именно для пожилых людей которые самые вероятные жертвы этого вируса , закупайтесь под потолок и пережидайте волну сидя дома и подальше от общества , ни в коем случае не рискуйте оказаться в госпитале и подхватить там больничную инфекцию . Она ничуть не лучше этого вируса в плане быстрого сведения в могилу . И тоже пневмония.

About empty shelves in supermarkets . That is the only option for old people to reduce chance for infection... That virus is old people problem, and they can solve it by self-imposed isolation and individual prophylactic measures . Simple as that. Just stock your house full with basic supplies from local supermarket and sit home and wait for a couple of months, till the end of May. My advice. The best option . Way better than to visit hospital and contract there MDR infection and die from it... it is also usually deadly untreatable pneumonia. Just not related to that virus.

Всего благодарностей: 1Поблагодарили (1): CowDoc
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 12.03.2020 16:50     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

В Италии вообще что-то очень подозрительное происходит.. Похоже на отжатие бабла из бюджета на медицинско-мафиозные нужды. Раздувают пожар из удобного повода.

Ну посадили бы всех рисковых пациентов под домашний арест и делов-то. Ну до Мая примерно, пусть носа на публику не кажут . А молодежь и особенно школьники пусть переболеет вся и вакцинировать даже не надо... все естественно и решится.

Всего благодарностей: 1Поблагодарили (1): CowDoc
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 12.03.2020 17:15     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

У меня вот биткойновая кубышка упала на 20% , неожиданно однако , я ожидал обратное движение ... Похоже вирус нащупал уязвимость в биткойне какую-то, впрочем вполне понытаную , он сильно зависит от Китая.

Впрочем это пожертвования мне на деятельность , не то чтобы катастрофа , но жалко
Участник оффлайн! Panaev
Постоянный участник



 прочитанное сообщение 12.03.2020 18:11     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 12.03.2020 18:15)
Ссылка на исходное сообщение  У меня вот биткойновая кубышка упала на 20% , неожиданно однако , я ожидал обратное движение ... Похоже вирус нащупал уязвимость  в биткойне какую-то, впрочем вполне понытаную , он сильно зависит от Китая.

Впрочем это пожертвования мне на деятельность , не то чтобы катастрофа , но жалко

Я бы об этом в последнюю очередь беспокоился.
А у вас есть кубышка с гречкой, тушенкой и патронами?
Участник оффлайн! Asterix
Постоянный участник



 прочитанное сообщение 13.03.2020 01:47     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

Я спагетти закупился и оливковым маслом... ну еще есть соусы разные ... тофу... картохи мешок, луку репчатого пол-мешка.... морква есть , орехи , мед , чай зеленый Эрл.

в конце концов я сам себе этот вирус вколю , чтоб подготовка к нему не пропала даром... С меня станется , и не такое вкалывал..

кстати следующее событие будет в Брусселе , 19-20 марта . Я буду вкалывать себе геномную ДНК рыбы , Золотого Тунца. А симфонический оркестр Брюсселя будет в это время играть Фантастическую Симфонию , Берлиоза ..

И кому-то в тот день отрежут голову .. или самолет упадет ... я не люблю будущее предсказывать, вот не уважаю я это занятие . это я вот так просто брякнул тут не подумав , но слово не воробей , уже вылетело.
Участник оффлайн! ИНО
Постоянный участник
Донецк



 прочитанное сообщение 13.03.2020 08:46     Сообщение для модератора  Сообщение для куратора темы       Личное письмо

Кстати , карантин мог бы стать вполне действенным средством при борьбе государства с массовыми народными волнениями политического характера. Достаточно сделать вброс инфекции , может быть даже и липовый и обьявить карантин , население напуганное предыдущими учениями покорно свернет несанкционированные сборища и будет сидеть по домам.

Ну Украине так и сделали: под шумок карантина откроют рынок земли.
Участник оффлайн! Bear
Постоянный участник
Москва



 прочитанное сообщение 13.03.2020 09:07     Сообщение для модератора  Сообщение для куратора темы       Фотография  Личное письмо  Отправить e-mail  Web-адрес

(Asterix @ 13.03.2020 02:47)
Ссылка на исходное сообщение  . Я буду вкалывать себе геномную ДНК  рыбы ,  Золотого Тунца.  А симфонический оркестр Брюсселя будет в это время играть  Фантастическую Симфонию ,  Берлиоза ..


Вы это... "гашка" - зло! Берегите себя.
Участник оффлайн! Panaev
Постоянный участник



 прочитанное сообщение 13.03.2020 10:29     Сообщение для модератора  Сообщение для куратора темы       Личное письмо  Отправить e-mail

(Asterix @ 20.02.2020 14:21)
Ссылка на исходное сообщение  Создавали его в Канаде, руководствуясь самой обычной логикой  исследований  и разработки вакцин.  Это в рамках проекта по [SARS-MERS] Видимо  скрининг шел на клеточных культурах.

А в Китай ауртсорсили работы на животных , что там существенно проще и дешевле чем  на Западе.

Ну и вот , не ожидали даже  такого...  впрочем  теперь видно  что работа удалась на славу.

Какой там на самом деле штамм особо опасный   мы скорее всего и не узнаем...  Китайское правительство плотно занялось дымовой завесой... разбавляют число заболевших   включая в них все что угодно ... лишь бы общую морталити удерживать  ниже 2%. Простое административное решение,  вполне китайское по-сути.   Хотя конечно оно наметанному глазу заметно  что все смерти  концентрируются в одном месте .. а заболевшие диагностируются по всему Китаю, но почему-то не мрут.

Сегодня в новостях наших мелькнуло. Погуглил china blamed us - никакой информации в ведущих новостных сайтах нет. Только вот на странном сайте нашел:
https://www.veteranstoday.com/2020/03/13/ch...s-as-influenza/

upd
а нет, это яндекс почему-то плохо индексирует вражеские средства smile.gif
https://nypost.com/2020/03/12/chinese-offic...on-us-military/

Сообщение было отредактировано Panaev - 13.03.2020 10:38

*




Кнопка "Транслит" перекодирует
текст из транслита в кирилицу.
Правила перекодировки здесь;
текст в квадратных скобках'[]'
не преобразуется.
Имя:

 преобразовывать смайлики · показать смайлики
Назначение кнопок:

   Поблагодарить автора сообщения — поблагодарить автора
   Удалить сообщение — удалить
   Редактировать сообщение — редактировать
   Поместить сообщение в колонку новостей — поместить в колонку новостей
   Цитировать — цитировать сообщение
   не входит в цитирование/входит в цитирование — цитировать несколько
   Отметить СПАМ-сообщение — обозначить спам
   Сообщение для модератора — связь с модератором
   Участник онлайн!/Участник оффлайн! — автор онлайн/оффлайн
   Фотография — фотография автора

   - остальные обозначения -
 
   *
« Предыдущая тема · Беседа · Следующая тема »
Быстрый ответДобавить сообщение в темуСоздать новую тему

Rambler   molbiol.ru - методы, информация и программы для молекулярных биологов              

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Ваш форум  ·  redactor@molbiol.ru  ·  реклама  ·  Дата и время: 21.10.21 18:51
Bridged By IpbWiki: Integration Of Invision Power Board and MediaWiki © GlobalSoft