Rambler's Top100
Лёгкая версия форума* Виртуальная клавиатура  English  
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы
Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда | Междисциплинарный биологический онлайн-журналZbio-wiki

NG SEQUENCING · ЖИЗНЬ РАСТЕНИЙ · БИОХИМИЯ · ГОРОДСКИЕ КОМАРЫ · А.А.ЛЮБИЩЕВ · ЗООМУЗЕЙ


Темы за 24 часа  [ Вход* | Регистрация* ]  
   



Форум: 
 

Щёлкните, чтобы внести в Избранные Темы* Праймеры для оценки экспрессии генов -- нужна небольшая консультация --
ИнтерЛабСервис - передовые технологии молекулярной диагностики
Операции: Хочу стать куратором* · Подписаться на тему* · Отправить страницу по e-mail · Версия для печати*
Внешний вид:* Схема · [ Стандартный ] · +Перв.сообщ.


 
Добавить сообщение в темуСоздать новую темуСоздать голосование
Участник оффлайн! Cinderella
Постоянный участник
где-то в Сибири



 прочитанное сообщение 12.01.2009 09:16     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #1 множественное цитирование

Вопрос многим может показаться диким, но нужно кое-что проянить. teapot.gif
вкратце: ставлю реал тайм ПЦР для оценки экспрессии генов с использованием TagMan. пробоподготовка: выделяю тотальную РНК, с нее получаю кДНК в реакции ОТ (использую рандом9). кДНК идет в саму ПЦР.
вопрос: праймеры подбирают с mRNA целевого гена или с DNA того же гена??

и еще confused.gif : хочу попробовать перейти на сайбр грин. можно ли использовать те же праймеры (без зонда естесттно) и тот же набор для ПЦР для ТagMan (вроде в наборе ничего такого нет, на мой взгляд). нужен ли подбор условий ПЦР по новой?

большое спасибо. smile.gif
Участник оффлайн! fbb
Участник



 прочитанное сообщение 12.01.2009 09:31     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #2 множественное цитирование

днказой обрабатываете выделенную рнк, чтобы остатки геномной днк убить? или у Вас праймеры на экзон-интрон подобраны, чтобы только с мРНК шло?
Участник оффлайн! Cinderella
Постоянный участник
где-то в Сибири



 прочитанное сообщение 12.01.2009 10:44     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #3 множественное цитирование

причем тут убить геномку?
для обычной ПЦР праймеры берут с ДНК, а для оценки экспрессии гена? праймеры писать с mRNA? или также с ДНК?
я вообще со статей брала и из базы. это не относиться к вопросу.
вопрос тот же с какой цепи писать праймеры?

и еще - где можно посмотерть где находяться интроны и экзона на цепи? ссылка или програма. плиииз.



mol.gif
и еще кто нибудь может мне сказать по поводу качества праймеров? можно ли такие использовать?
на актин

Сообщение было отредактировано Cinderella - 12.01.2009 10:46

Файл/ы:

____________.htm
размер: 46.18к
кол-во скачиваний: 10
12.01.2009 — 26.01.2009


________________________________..txt
размер: 1.09к
кол-во скачиваний: 6
12.01.2009 — 26.01.2009


____________.htm
размер: 128.38к
кол-во скачиваний: 5
12.01.2009 — 26.01.2009

Участник оффлайн! Cinderella
Постоянный участник
где-то в Сибири



 прочитанное сообщение 12.01.2009 12:30     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #4 множественное цитирование

плииииззззззззззз mol.gif weep.gif
Участник оффлайн! semi
Постоянный участник
Москва



 прочитанное сообщение 12.01.2009 14:48     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #5 множественное цитирование

Не совсем поняла вопроса, да я и сама не шибко большой спец.
Данные программы "Primer-BLAST: Finding primers specific to your PCR template (using Primer3 and BLAST). http://www.ncbi.nlm.nih.gov/tools/primer-b...LOC=BlastHomeAd :
Первый набор праймеров (Forward primer CCTTCACTGCCTGGTGTAAC; Reverse primer TTCCTATGGGGTCATCCTTG )соответсвует mRNA Homo sapiens actinin, alpha 2 (ACTN2), mRNA , положение 332-835, длина ПЦР-продукта 504, экзоны 2-6. Видимо, можно получить ПЦР продукт с мРНК actinin, alpha 3 (ACTN3), с той длиной продукта, разница в буквах по Forward primer -1 буква, по Reverse primer - 2 буквы, одна на 3' конце. Ваша проба AGCAAAGGGGTGAAACTGGTGTC комплиментарна как мРНК актинина 2, так мРНК актинина3 (в последнем случае есть несовпадение двух букв).
Второй набор - практически все то же самое то же самое, но длина продукта 268, положение 370-637, опять есть вероятность получить ПЦР продукт с мРНК actinin, alpha 3 (ACTN3), с той длиной продукта.

ДНК последовательность NC_000001 не нужна, т.к. кДНК строится по мРНК, где уже нет интронов, у вас продукт включает несколько экзонов. ДНКазить вроде бы не нужно, т.к. с геномной ДНК продукта вроде бы никакого не должно получаться.

Я бы (от греха подальше) брала другой набор праймеров, для которых нет вероятности поднять продукт другого гена. confused.gif confused.gif

Всего благодарностей: 1Поблагодарили (1): Cinderella
Участник оффлайн! ship
Постоянный участник
Moscow



 прочитанное сообщение 12.01.2009 15:15     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #6 множественное цитирование

праймеры подобрать не могут, зато РЕАЛ-ТАЙМ ПЦР делают!
Ъ
IP-штамп: frzi5.baR3A8I
гость



 прочитанное сообщение 12.01.2009 16:02     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #7 множественное цитирование

(ship @ 12.01.2009 14:15)
Ссылка на исходное сообщение  праймеры подобрать не могут, зато РЕАЛ-ТАЙМ ПЦР делают!

Всяко бывает. В наше время начинать с конца - самое то... smile.gif
А semi молодец не поленилась побластить и даже рекомендации дает.
По мне: прраймеры как праймеры. confused.gif Можно и с сибром использовать.
http://www.gene-quantification.info/
http://normalisation.gene-quantification.info/
Участник оффлайн! Cinderella
Постоянный участник
где-то в Сибири



 прочитанное сообщение 13.01.2009 07:18     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #8 множественное цитирование

semi
да я замучилась праймеры искать. такая фигня все. а вроде эти ничего.

ship
праймеры подобраны, но они не работают. есть праймеры взятые со статей или с баз праймер 3. проверила - очень плохие. там вообще не известно откуда взяты...
Участник оффлайн! чайник555
Постоянный участник
Сибир-р-р-ръ



 прочитанное сообщение 13.01.2009 07:48     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #9 множественное цитирование

(ship @ 12.01.2009 12:15)
Ссылка на исходное сообщение  праймеры подобрать не могут, зато РЕАЛ-ТАЙМ ПЦР делают!

Когда прибор не работает, приходится читать инструкцию...
Если опыт получается с первого раза, значит он проведён неверно...
Участник оффлайн! Cinderella
Постоянный участник
где-то в Сибири



 прочитанное сообщение 13.01.2009 09:01     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #10 множественное цитирование

(чайник555 @ 13.01.2009 07:48)
Ссылка на исходное сообщение  Когда прибор не работает, приходится читать инструкцию...
Если опыт получается с первого раза, значит он проведён неверно...

если тебе пофиг на результаты - можно и шлепать то что получается
а можно вообще нарисовать и не париться

Сообщение было отредактировано Cinderella - 13.01.2009 09:01
Участник оффлайн! Kiskin
Постоянный участник



 прочитанное сообщение 13.01.2009 10:55     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #11 множественное цитирование

Ну точно тот же вопрос той же участницей был задан полгода назад. Cinderella, Вам это не странно ?
Участник оффлайн! Cinderella
Постоянный участник
где-то в Сибири



 прочитанное сообщение 20.01.2009 06:41     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #12 множественное цитирование

странно, но вопрос не такой был и не про это. просто мне так никто и не сказал - правильно я делаю или нет. все только умничают и ехидничают, за очень редким , очень редким исключением, за что им глубокое спасибо.
Участник оффлайн! Derro
Постоянный участник



 прочитанное сообщение 21.01.2009 17:14     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #13 множественное цитирование

Синдерелла, ну а что вы хотели? В принципе, вопрос "праймеры подбирают с mRNA целевого гена или с DNA того же гена" адекватен и правилен. Но! Человека не знающего ответа на этот вопрос я бы ни к одному реал-тайму бы не допустил. Не сочтите за оскорбление, но чтобы ответить на этот вопрос достаточно знать лишь теорию ПЦР и общий курс молекулярной биологии на троечку. Как же тут не ехидничать, если вам проще поморать экран, чем на пару минут включить голову.

Без обид.

Всего благодарностей: 1Поблагодарили (1): ship
Участник оффлайн! Statin
Постоянный участник



 прочитанное сообщение 21.01.2009 19:20     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #14 множественное цитирование

Хорошо, что semi проверил праймеры и они дествительно чему-то соответствуют, зачастую в статьях намеренно дают неправильную последовательность праймеров, а в базы сливают всякие абортусы (с большой кучей вторичных структур).
Подбирайте праймеры сами, берите мРНК и подбирайте на стыке экзонов, потом проверяйте по ДНК, желательно, чтобы продукта не было или был, но очень длинный.
Участник оффлайн! Начинающий
Участник



 прочитанное сообщение 22.01.2009 13:31     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #15 множественное цитирование

короче делаешь так, заходишь в pubmed вводишь название гена, далее слева выбираешь nucleotide (по умолчанию стоит pubmed) делаешь поиск, выбираешь нужный организм, mus musculus например если с мышами, идешь ниже, там должно быть mRNA and Protein(s) в этой колонке стоит gene ID базы данных NCBI обычно это что-то типа NM_079486.3 копируешь эту штучку. Актин не очень удачный пример, так как много их сильно, но неважно...
Далее открываешь эксплорер (firefox, whatever) idtdna.com там выбираешь SciTools потом PrimerQuest, далее думаю разберешься, если нет пиши объясню детали.
Эта программа онлайн для дизайна праймеров, фактически из базы данных NCBI ты вводишь последовательность гена а прога тебе уже сама подбирает праймеры. Праймеры сделанные таким образом работают!!! проверено!!!
и не надо будет тебе заморачиваться на счет DNA mRA и тд.
На счет TaqManа, праймеры может и подойдут к SYBR, но обычно они в одной смеси с пробой продаются поэтому разделить их нельзя. Попробуй сначала сделать SYBR это примерно в 5-10 раз дешевле чем TaqMan. Если что-то не работает, то возможно проблема с cDNA у меня иногда быват, что используя одну и ту же методику получения cDNA реал тайм почему-то не работает, проще выкинуть и сделать новую.
Участник оффлайн! Derro
Постоянный участник



 прочитанное сообщение 22.01.2009 17:05     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #16 множественное цитирование

м...да... А я бы посоветовал сначала с листком бумажки и карандашиком посидеть, чтобы на веки вечные в голову вбилось. Начинающий, а не подскажите какойнить он-лайн тул для анализа полученных Синдереллой результатов?
Участник оффлайн! Начинающий
Участник



 прочитанное сообщение 22.01.2009 18:28     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #17 множественное цитирование

так а чего там собственно считать, взял средние значения C(T) в формулу подставил да и все. Я обычно в exele делаю, хотя есть у меня знакомый пользуется програмулиной одной не помню как называется, но собственно фишка проги в том, что там эта формула уже вбита и после подстановки средних значений C(T) она выдает результат. Единственное что могу посоветовать еще это делать triplicates, даже не знаю на русском этого слова smile.gif)) в общем с одной и той же пробой минимум три раза повторить эксперимент просто, чтобы совесть чиста была smile.gif но я думаю это и так все знают...
Участник оффлайн! svetbatalia




 прочитанное сообщение 28.03.2021 23:40     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #18 множественное цитирование

(Cinderella @ 13.01.2009 08:18)
Ссылка на исходное сообщение  semi
да я замучилась праймеры искать. такая фигня все. а вроде эти ничего.

ship
праймеры подобраны, но они не работают. есть праймеры взятые со статей или с баз праймер 3. проверила - очень плохие. там вообще не известно откуда взяты...


А как вы по статьям искали? Я понимаю, что вопрос глупый, но мы по факту еще не проходили, а на проекте требуют. Я пыталась искать через статьи на pubmed и nbci, но по факту не нашла. Такое чувство, что просто неправильно делаю
Участник оффлайн! watchesbiz
Постоянный участник



 прочитанное сообщение Сообщение на английском  27.09.2021 17:03     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #19 множественное цитирование

https://app.ex.co/stories/bestreplicawatche...-regime-for-you
https://rolexrelicawatches.hpage.com/replica-watches-uk.html
https://www.cgmimm.com/articles/hints-to-he...lica-watches-uk
https://www.deviantart.com/fakerolexwatches...es-UK-871090193
https://replicawatches24.exposure.co/best-r...eplicawatches24
https://knowyourmeme.com/users/replicawatchesuk
https://www.scoop.it/topic/bestreplicawatch...ica-rolex-watch
https://uberant.com/article/1268140-hints-o...ca-rolex-watch/
https://devpost.com/watcheshutuk
https://www.ted.com/profiles/26540630/about
https://drive.google.com/file/d/1uTx90WraSJ...iew?usp=sharing
https://ibb.co/hgfZwb0
https://writer.zohopublic.com/writer/publis...10192bd4c742ceb
https://replicawatches24.mystrikingly.com/b...ica-rolex-watch
https://my.desktopnexus.com/ReplicawatchesU...a-rolex--31049/
https://sway.office.com/Tqm7mC7s0VWLhKAl

*




Кнопка "Транслит" перекодирует
текст из транслита в кирилицу.
Правила перекодировки здесь;
текст в квадратных скобках'[]'
не преобразуется.
Имя:

 преобразовывать смайлики · показать смайлики
Назначение кнопок:

   Поблагодарить автора сообщения — поблагодарить автора
   Удалить сообщение — удалить
   Редактировать сообщение — редактировать
   Поместить сообщение в колонку новостей — поместить в колонку новостей
   Цитировать — цитировать сообщение
   не входит в цитирование/входит в цитирование — цитировать несколько
   Отметить СПАМ-сообщение — обозначить спам
   Сообщение для модератора — связь с модератором
   Участник онлайн!/Участник оффлайн! — автор онлайн/оффлайн
   Фотография — фотография автора

   - остальные обозначения -
 
   *
« Предыдущая тема · Молекулярная и клеточная биология · Следующая тема »
Быстрый ответДобавить сообщение в темуСоздать новую тему

Rambler   molbiol.ru - методы, информация и программы для молекулярных биологов              

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Ваш форум  ·  redactor@molbiol.ru  ·  реклама  ·  Дата и время: 17.10.21 23:33
Bridged By IpbWiki: Integration Of Invision Power Board and MediaWiki © GlobalSoft