Все форумы > Беседа > версия для печати
Web-адрес темы: http://molbiol.ru/forums/index.php?s=96207f3062af6b4f85f7925cbcd6ea14&act=ST&f=21&t=594129

Эзотерическое знание

Asterix 15.06.2019 03:50
Эзотерическое знание

Краткий курс эзотерики для Ph.D.

Меня попросили рассказать о древних знаниях и поделиться своими находками. Материала очень много. Если покажется интересным, буду выкладывать кусочками.
Кусочек первый.
Меня будут упрекать лингвисты в надуманности построений и измышлизмах на тему, но «имеющий уши да услышит».
Был язык человека современного Нomo sapiens создан или он возник из подражания природным звукам? Почему мы не мычим как коровы и не шипим как змеи? Знаем ли мы свой язык и почему мы называем предметы так, а не иначе.
Лингвистика нас учит, что русский язык входит в группу индоевропейских языков наряду с романскими, германскими, персидским и арабским языками. В школе нас учат, что слова имеют неизменяемую корень-основу. Например, в слове «дорога» корень «дорог», а в слове «корова» - «коров». Если отбросить гласные, получим «дрг» и «крв». А в слове «бык» - «бк», в слове «карандаш» - «крндш». Как видим, количество согласных звуков в корнях слов разное. Чаще встречаются два и три. Арабисты скажут, что в арабском языке корни всех слов содержат только три согласных звука. Возможно, среди индоевропейских языков есть и такой, в котором корни всех слов состоят из двух согласных звуков. Поищем его.
Числа и 2 и 3 лежат в основе практически всех структур во вселенной. Но об этом поговорим в другой раз, а сейчас попробуем найти слова на основе числа 2 и реконструировать их смыслы.
Начнем с корня «гр-рг». В санскрите слова читаются слева направо и справа налево. Разберем пока только корень «гр». Согласно фонетическим правилам он дает «куст» корней: «гр-жр-хр-кр-ср», а также «гл-жл-хл-кл-сл». Возьмем только одну огласовку гласным «о». Получим «гор-жор-хор-кор-сор», а также «гол-жол-хол-кол-сол». Из них образуем знакомые ключевые слова: «гора, хоровод, жир, корова» и «голова, холод, кол,жо (е)лтый, солнце». Со словом «сор» разберемся отдельно попозже. Все эти слова образуют группу символов, на которых построены арийские знания, заключенные в скандинавских, славянских, греческих, шумеро-аккадских, египетских и других мифах. Слова могут произноситься по-разному, так как пройден большой исторический путь, но смысловая основа у всех одна.
Во всех мифах есть корова: у скандинавов – Аудумла, у египтян – Хатхор, в Ригведе бог огня Агни – бык, у греков бык Зевс и корова Гера, у шумер – бог неба бык Ану. Бык и корова связаны с небом и солнцем и только Аудумла вылизывает ледяную гору («гр-кр – гора-корова») Имира. Когда Имира убивают боги, из него вытекает горячая красная кровь («гр-кр – горячая кровь»), в которой утонула корова. Небесная корова Хат-Хор рождает солнце Гора («гор – горячий»). В теле горы-коровы течет горячая кровь, а в ее утробе зреет сын-солнце. Само тело должно быть холодным («гор-хол»), а солнце рождается из головы («гор-гол») у коровы между рогами («гор-рог»). Жену Зевса Геру называли «волоокой», а ей в жертву приносились коровы. Бык Зевс-зов громко кричит («гр-гл – глас», «гр-кр – крик»), а раскаты грома («гр – гром») сопровождаются вспышками молнии-зари («сол-зол-зор-зар»). Это полыхает яростный огонь (жар) Агни. Агни золотистого цвета («жол-зол-сол»), он окропляется жиром, так как горящий жир испускает сильный жар («жар-жир»). Брахманы поливали жертвенный костер жиром («жр-гр» - жертва, жерло, горло»). Буддийские монахи в Тибете пьют чай с добавлением жира яка и носят желтые и красные одежды.
ТОРА: " сын мой, будь крайне осторожен при переписывании Слова Божьего, ибо, не дописав один знак или внеся один лишний, ты можешь разрушить всю вселенную". Поменяв одну букву в слове, можно полностью изменить его смысл. Слова - это СМЫСЛЫ.



Asterix 15.06.2019 04:01
ПРОДОЛЖИМ
ГОРА
Гора (символ Ʌ) должна быть холодной, ледяной. Гора – форма, которая образуется из воды под действием холода и отражает переходы «гор-хол – горячий-холодный», т.е. текучий и твердый, бесформенный и имеющий форму, вода и лед. Тогда «лед-лад», где «лад» - организация в порядок отдельных кристаллов-снежинок. В скандинавской мифологии ледяная глыба («гл-гр») имеет форму человека-горы, Имира. Его вылизывает изо льда корова Аудумла. Человек подобен горе: он стоит прямо, упираясь головой в небосвод, его тело покрыто коркой-корой-кожей («гр-кр»), а внутри течет горячая кровь. В утробе ледяной глыбы также спрятан огонь. Именно благодаря внутреннему жару гора тает, и с нее стекают потоки воды. Гора тает летом, а из ее чрева на небо выкатывается жаркое летнее солнце: «лд-лт» - лед-лето.
Итак, белая ледяная гора с жаром внутри: русская беленая печь и буддийская белая ступа. В «Ригведе» с тающей горы Валы стекает 7 потоков в океан, поэтому гора должна иметь 7 ступеней. И преобразуется в 7-миступенчатую пирамиду. В шумеро-аккадских мифах на водном потоке Апсу вырастает холм, в котором зарождается солнечный бог Мардук. В египетских мифах из водной пучины Нун поднимается остров Бен-бен. В славянской мифологии это остров Буян. Гора, вырастающая из вод, - ледяная. Она необязательно вся белая, но уж вершина должна быть белой-снежной-ледяной непременно. Вершина должна таять, а с нее текут ТАЛые воды («алт-тал»). Такова арийская Вала, а вот славянский бел-горюч камень АЛаТырь превращается сразу в пар – бога ветра Семаргла.
«Лед-лето», «лед-лад» и «ЛАТ-АТЛ-АЛТ-ТЛА-ТАЛ». АТЛ – АТЛант, человек-гора, удерживающий на своих плечах небосвод на далеком севере. Его друг – змей ЛАДон, лежащий на дне реки, у которой одна струйка белая (холодная), другая – красная (горячая). Такова же и река Смородинка, через которую перекинут Калинов мост, ведущий к горе, охраняемой Змеем Горынычем («горный-горячий»). Сколько еще таких гор? АЛТай, АЛаТау, АРаРат («алт-арт»). Но самая знаменитая гора – греческая ЛАТона. Она рождает сына и дочь, свет и тьму: АПоЛлона («атл-апл») и АРТемиду. Животное Аполлона – белый лебедь («бл-лб»), Артемиды – бурый медведь («бур-бер»). Белый и бурый («бл-бр») – свет и тьма.
Знак Ʌ как раз и обозначает рождение противоположностей из одной точки (вершина горы). Эта пара противоположностей: «правое-левое», «свет-тьма», «вода-огонь». У славян бог Род рождает сына бога огня Сварога (справа) и холодную дочь Ладу («лад-лед») (слева). В Торе бог создает двух ангелов Микаэля и Габриэля. Микаэль (справа) – ангел воды и юга, Габриэль (слева) – ангел огня и севера. И только арийский Праджапати рождает трех сыновей: холодного творца Тваштара, жаркого рыжего Рудру и змея Дасу. О змеях мы поговорим отдельно.
Как видно, все эти смыслы могли быть рождены только в северных широтах, так как только там вода превращается в лед зимой (тьма), а лед тает летом (свет).



Asterix 15.06.2019 04:02
КОСОЙ КРЕСТ
Символы РОГ-ГОР = V-Ʌ надо сложить вместе, так как они – две противоположные части одного процесса и одной структуры – ЕДИНОГО. Складываются они тремя разными способами: как знак Х (КОСОЙ КРЕСТ), знак ◊ (РОМБ) и знак N.
Сегодня наша тема КОСОЙ КРЕСТ. КОСОЙ КРЕСТ – древнейшая модель вселенной, в которой запечатлен основной закон «собирание-разбрасывание», «сжатие-расширение». Действительно, знак V – чаша («cup», англ.), в которой что-то собирается, концентрируясь на дне – точке-вершине угла. В древности чаша наполнялась водой и представляла собой бездну-хаос-тьму. Но в этой же чаше могло собираться и молоко, которое выдаивалось из вымени небесной коровы. Капли молока – звезды. Они дали название нашей галактике: «Млечный путь». На небе, пространстве вод, россыпь звезд собиралась в чашу-месяц, наполняя ее до полной луны. Про модель Х говорили: «Идет с косой косой козел», где коса – это и лунный месяц, и серп. Почему козел? Потому что у него рога и раздвоенное копыто. Английское слово cup (чаша) – оно же купол, копыто, капитель, кепка и капуста. Просто иногда в корнях «рог-гор» верх и низ менялись местами, и чаша-копыто становилась горой-куполом.
На дне чаши ее содержимое сжималось в точку и самовозгоралось, испуская свет и тепло. Знак Ʌ - купол, из вершины которого исходят потоки-волны света и жара. Так холодная луна разгорается в жаркое солнце. КОСОЙ КРЕСТ собирает и рассеивает энергию, а точка перекрестья – преобразователь невидимого в видимое, а видимое – это вселенная, тварный мир. Звуки «к-г» и «с-з» были взаимозаменяемыми, и корни «рог-гор» звучали как «рос-сор», а также «рас-сар». Пара «сор-рас» преобразовалась в приставки, означающие противоположные действия. Приставка «со-с» указывает на действия со-бирания и с-жатия, а приставка «рас-раз» - раз-брасывания и рас-ширения. Этот основной закон «соединение-разъединение» запечатлен в паре арийских богов Митра-Варуна. Митра-мир – со-гласие. А вот Варуна связан с водами, в его имени кроется слово «вар», т.е. « варить-варево», «раз-варивание», которое происходит в горячей воде. Слово «вар» - это «пар» и «фар» (фара). В пар превращается горячая вода, и он рассеивается (воздух) в пространстве, как и фар (жаркий свет). «Фар» - это fire (огонь, англ.). От слова «рас» были произведены сразу три слова «ас», «ра» и «ар». «Ас» - это ясный («ас-яс») и Асгард, где жили скандинавские светлые боги, «ра» - бог солнца Ра, а «ар» - арьи, народ, рас-селяющийся-рас-пространяющийся по всей ойкумене. Ну а «рас-рус-рос» - это светлые люди русы-росы, а также рус-алки («ар-ал»).
«Выткался на озере алый свет зари» (С.Есенин): «ал-алый», «зар-заря», «зор-зер-зеркало-озеро». И наступил рас-свет.
Вспомним про бел-горюч камень Алатырь и гору Латону, в названиях которых спрятан корень «тл-тр», а в печи-пешере дремлет до поры, до времени огонь (свет и жар). В огнедышащем вулкане пламя-жар выходит из его горла-жерла. Так же выкатывается и солнце из горы на севере летом, а на юге утром. Итак, огонь зреет в теле горы, в ее «уТРобе». Когда плод созревает он из утробы поступает в «ТРубу-горло», а из нее в «РоТ». Рот рас-крывается как рас-труб, изо рта в широкое пространство выкатывается солнце, и наступает «уТРо». Рот – это ночь: на ночном небе-нёбе сверкают белые звезды-зубы («зв-зб»).
Понятно, что двоичный КОСОЙ КРЕСТ был бельмом на глазу у отцов христианской церкви, насаждавших троицу и прямой крест. И невинный КОСОЙ КОЗЕЛ был превращен в черта, который крадет звезды ночью на хуторе близ Диканьки.
Про КОСОЙ КРЕСТ, однако, не забыл Леонардо да Винчи. Он соединил его с прямым крестом в образе витрувианского человека. На картинке человек стоит с поднятыми руками и раз-двинутыми ногами, а перекрестье находится в «солнечном сплетении». Потому-то это сплетение и «солнечное». А вот «сол-зол» бывает не только золотом, но и «злом» («зол-зло»), превращающем белое в черную «золу». Да уж, удар в «солнечное сплетение» может стать смертельным.



Asterix 15.06.2019 04:03
КОЛЕСО
Часть 1
В слове «колесо» тот же корень «рг-гр» («рог-гор-гол-кол») и оно имеет прямое отношение как к «мировой оси»-колу, так и к солнцу («кол-сол»). Оно бы и имело всем знакомое значение годового цикла солнца («коловорот»), если бы не появились более глубокие и более общие смыслы.
Образом «мировой оси» сначала служил кол, соединяющий пуп земли с Полярной звездой (на севере) и с солнцем в зените (на юге). Затем им стали гора, дерево, медведь и человек. Кол крепко связался с солнцем, которое располагалось на вершине горы (выкатывалось из жерла), дерева, прямостоящего медведя и человека (голова). Однако кол, вертикальная линия, имеет и другое значение – он соединяет небо и землю и является каналом обмена между ними: по колу небо передает энергию земле (дух нисходящий), а земля – небу (дух восходящий). Есть огонь небесный, но есть и огонь земной. Арии называли этот канал передачи «столб Аю». Его двумя руками держал бог огня Агни. И жертвенные костры, обильно политые жаром-жиром, арийские жрецы устраивали для того, чтобы черный дым напитал небо и простимулировал его ниспослать на землю дары. Дары – это энергия, воплощенная в сыновьях и стадах, т.е. фактор размножения – семя. Небо – отец, земля – мать.
И все же, свет возникает из тьмы, а холодная луна на ночном небе воспламеняется жаром: свет и жар рождаются в утробе тьмы-матери («тм-мт»): темное небо передает энергию света и тепла земле, освещая ее летом (на севере) и днем (на юге). Канал передачи «сверху вниз» изображается символом Ж. Этот символ называли «жар-птица», так как он похож на птицу: тело и два крыла, а также на золотую пчелу, производящую золотой мед. В словах "птица" и "пчела" корень «пт-пч», такой же, как в словах «печь» и «пещера». Из пчелиного воска делают белую горючую свечу, пламенеющую на макушке. Свеча – образ ледяной горы: воск тает так же, как лед. Корень «пт» - в слове «пять», а пять – число водоплавающей птицы, у которой два крыла и трехпалая лапа. Белые лебедь и гусь сносят в первозданные воды «мировое яйцо», а серая уточка достает со дна моря кусочек земли. Из него образуется остров Буян, на котором как раз и находится бел-горюч камень Алатырь.
Символ Ж называли еще «шестокрылом» (шест с крыльями). У него шесть углов, от него пошло и слово «шесть». Число 5 раскладывается как 2+3, число 6 – как 2х3, а 5+6=11, или число «золотого отношения», мировой гармонии. Кстати, пчела делает соты в виде правильных шестиугольников. На числах 2 и 3 строится древнейшая картина мира, а мир разделяется на две половины: чет и нечет, между которыми снует единица. Единица – это и угол, и вертикальная линия, столб Аю,канал передачи между верхом и низом. На две половины, верх и низ, делит вселенную горизонтальная линия. Вместе, горизонтальная и вертикальная, линии образуют прямой крест.
Объединим при построении единой картины мироздания косой крест с прямым крестом и получим восьмиугольник, или 23 (два в кубе) - новый символ вселенной.



Asterix 15.06.2019 04:04
КОЛЕСО
Часть 2.
Знак КОСОЙ КРЕСТ Х представляет собой две чаши: одна, верхняя, наполняется, вторая, нижняя, выливает содержимое. В знаке Ж вдоль канала передачи, сверху вниз, непрерывно течет поток: он берется ниоткуда и уходит в никуда, а стороны углов – лучи, устремляющиеся в бесконечность. Одна чаша наполняется, а другая изливается непрерывно, в то время как знак Х остается неподвижным. Такое возможно только в беспредельном пространстве вечности, в котором ничего не происходит: нет ни Сущего, ни Не-Сущего, и Все содержится в Ничто. В точке-перекрестья колышется слабое дыхание, мерцание-моргание («мр» - мрак и смерть). Чтобы такое потенциальное состояние стало действительностью, в беспредельном пространстве должен появиться предел, т.е. оно должно стать замкнутым, приобрести форму. Обретение предела означает, что у знака Х обрезаются лучи, преобразуясь в отрезки-усы, а емкость чаши становится конечной. Появляется мера: сколько влилось в чашу, столько из нее и вылилось. Закон сохранения энергии: если в одном месте убыло, то в другом ровно столько же и прибыло. Следовательно, вылившееся из нижней чаши должно снова наполнить верхнюю до краев. И процесс должен быть непрерывным. Это легко изображается и понимается, если представить, что знак Х вращается, а чаши попеременно то наполняются, то опорожняются. Точка перекрестья является осью вращения. Объем верхней чаши должен быть равен объему нижней, что достигается, если стороны углов одинаковы по длине. Бесконечные лучи знака Х становятся конечными отрезками-усами и описывают при вращении окружность. Пространство принимает форму круга («гр-кр»). Вращающийся круг – колесо, а ось вращения – кол. Пространство круга – море, из которого вырастает остров-гора, ось вращения. Круг может вращаться только в две стороны – вправо и влево, что соответствует двум сторонам угла, где левая сторона – тьма и вода, а правая – свет и жар.
Наполняющаяся верхняя чаша – тьма, опрокинутая нижняя чаша – свет: тьма-мать («тм-мт») рождает свет. Свет расширяется, заполняя пространство. Когда он весь изливается, его вновь скрывает тьма: тьма и свет, ночь и день чередуются. Ночь – символ V, день – символ Ʌ, вместе – символ N. Усы-стороны углов при вращении Х и N описывают окружность круга. Только у круга, в который вписан знак N (символ «инь-ян»), нет центральной точки - нет оси вращения, а круг попеременно становится то темным и холодным («инь»), то светлым и горячим («ян»). Две точки в символе обозначают вершины углов, так как в конечном изображении углы уже трудно разглядеть, а круг поделен надвое волнистой линией. Косой крест при вписании в круг делит его на четыре одинаковых равнобедренных треугольника - части вписанного в круг квадрата. Усы косого креста – ра-ди-усы («ра» - расширение, «ди» - два) круга и диагонали квадрата. Так получали и изучали квадратуру круга. Платон считал равнобедренный треугольник основной формой вселенной.
Угол V символизирует собирание-сжатие, угол Ʌ - разбрасывание-расширение. Эти смыслы передаются формой круговой спирали, которая скручивается в точку (сжатие) и раскручивается из точки (расширение). Скручивание – смерть-мрак, раскручивание – свет-жизнь. Скручивается влево – там холод и тьма, раскручивается вправо – там свет и тепло. Символ двух спиралей, левой и правой, – баран с его крутыми рогами (еще одно после коровы и козла рогатое животное). В слове «баран» корень «бр-пр»- бурый, но также спираль, лабиринт и даже пирамида. Молодой баран – овен, т.е. hoven (юноша, исп.) и oven (печь, англ.). Это та самая точка-перекрестье, из которой спираль раскручивается и в которую скручивается. Эта точка – огонь, движущая сила. Поэтому агнца зажаривали на костре, принося его в жертву огню ("аг-ог").



Asterix 15.06.2019 04:05
КОЛЕСО
Часть 3.
Итак, корень «гр-рг» преобразуется фонетически в корни «жр-гл-кл-кр». Корень «кл» в словах «кол», «колесо», «кольцо», корень «кр» в словах «крыло», «крыша-кров-кровь», «круг». Как они связаны между собой? Колесо – это вращающийся круг, ось вращения – кол, окружность – кольцо. Вращение – вид движения, крылья – механизм движения в воздушном пространстве, кровообращение (циркуляция, движение по кругу) внутри тела (скрытое). Круговорот – поворот косого креста, когда наполненная чаша опорожняется и вновь наполняется: она собирает и разбрасывает свет. Но приводит ее в движение огонь-тепло-жар (тапас, арийск. - тепло птицы «тп-пт»).
Огонь имеет тот же корень – редуцированный «рог-ог-аг». Арийский бог огня Агни и героиня русских сказок Баба Яга, которая на самом деле мужского рода. Движение передается корнями «ог-го» и «Аг-га» в словах «нога», «гад-змей» и Наг-змей, «go,англ. – идти» и «год» - «God,англ. – бог», а также передает течение рек Вол-га, Оне-га, Пине-га. Действительно, согласно Ригведе «жизнедеятельное было порождено силою жара», а Агни «возник из вод как единая жизненная сила богов».
Огонь «виновен» в чередовании «рог-гор-рог-гор..», т.е. тьмы и света. Круговращение в символе «инь-ян» развертывается в линейный луч-зигзаг VVVVV…, напоминающий по форме змею и волну. Поэтому Змей – Горыныч, т.е. горячий. Он становится драконом, когда у него вырастают крылья. Горыныч извергает пламя, а египетский змей Кнеф дышит на воду в чаше, вызывая в ней волны. Вспомним, что знак V – чаша, собирающая свет, т.е. тьма, а знак Ʌ - опрокинутая чаша, испускающая свет. Зигзаг – это линейное чередование периодов тьмы и света. На севере – это зима и лето (год), на юге – ночь и день (сутки). В арийских мифах круг риту образуют адитьи, семь сыновей Адити, а космос начинается с тьмы вод. Поэтому в тибетских храмах перед Буддой стоят в ряд семь чаш, наполненных водой, или зигзаг VVVVVVV, в котором семь ночей и шесть дней, или 13 углов. Число 13 входит в реккурентный ряд Фибоначчи «золотое сечение»: 0,1,1,2,3,5,8,13…, занимая восьмую позицию. Поэтому в кругу риты появляется восьмой сын Мартанда. Число семь – это космогоническая последовательность: Праджапати («господин всего»), три сына (Тваштар, Рудра и Дакши) и три дочери (Дити, Адити и Дасу). В библейской традиции имя бога скрыто в облаках и туманах, а в его числе скрыто число шесть. Поэтому мир начинается со света, т.е. с первого дня. Дней, ес-но, должно быть шесть. Получаем зигзаг ɅɅɅɅɅɅ, или шесть дней (шестоднев), пять ночей и 11 углов. Число 11 – число реккурентного ряда Люка и занимает шестую позицию.
Каббала
«Сэфер Ецира»
Тридцатью двумя открытыми путями нисхождения высшего света установила высшая сила свою власть, управление, могущество, вечность, отделенность, единство ( 32=25)
Десять сфирот скрытой высшей силы, они же проявляются в двадцати двух основных свойствах (22=11х2)
Число 32 многозначное. Во-первых, оно состоит из чисел 3 и 2, которые в сумме дают число 5. Во-вторых, числа 2, 3 и 5 находятся в определенном отношении: 32=25. Каббалисты утверждают, что 32 = 10+22, где 10 – количество чисел, а 22 – букв. Этими числами и буквами можно описать всю вселенную.
«Сефир Иецира» число 231: 11х7=77х3=231 - единая замкнутая система (7+3=10)
Но 7 и 3 – числа арийского Агни: «достойные жертв (боги) нашли спрятанные в тебе трижды семь тайных слов»
Повторяемость семи- и шестичленных последовательностей символизируется замыканием змея в круг (змей, ухвативший свой хвост) и получаем циклическое время: сутки, год, юга и последовательность циклов. В основу цикла было положено число шесть как 3х2 (3+3), или шестокрыл. Его потом переделали в два треугольника и звезду Давида. Понятно, что шестокрыл сделался дьяволом с числом 666. Интересно, что 6х6=36, а один цикл (символ цикла число 0) - 360, что практически соответствует числу земного года, т.е. количеству суток, умещающихся в северный период «зима-лето».
Змей, свернувшийся кольцом, все равно остается змеем, т.е огнем – горынычем. А рога-чаша – атрибут головы («гор-гол»), которая собирает свет, разгорающийся в жар. Так и змей-кольцо был надет на голову и превратился в корону («гор-кор»). Египетские фараоны предпочитали не скрывать, что корона – это змей все-таки, и змей-урей венчал их царственные головы. Змей Мидгард обвивает кольцом землю Мидгард в скандинавской структуре вселенной. Он ее огораживает. Отсюда и слово «огород-город» («гор-гр»). И ограда вокруг крома-кремля («кр») воздвигается в виде зубчатой стены.



Asterix 15.06.2019 04:05
РОМБ
Часть 1
Два знака «рог-гор», V и Ʌ, составляют единое целое, которое изображается как «косой крест» Х, колесо «инь-ян» N и ромб ◊. Мы уже поговорили о «косом кресте» и о колесе, дошла очередь до ромба. Ромб противоположен «косому кресту». В знаке Х чаша сначала наполняется, а затем опорожняется, т.е. ночь-тьма предшествует дню-свету, так как в знаке V свет сжимается-собирается в вершину угла-голову («гл»), а в знаке Ʌ вершина излучает сжатый свет, он расширяется, заполняя пространство. Эта последовательность смены тьмы и света развертывается как зигзаг VVVV…. Такая развертка принята в буддизме. Она подчеркивает, что вначале была тьма. Вращение знака Х предполагает, что сколько вылилось, столько и собралось снова в чашу-рог. Поэтому пространство должно быть ограничено и содержать определенное количество света. Вращение предполагает, что пространство ограничено окружностью-кольцом и представляет собой круг-колесо («кр-кл»). В ромбе все наоборот: свет сначала испускается верхней вершиной-горой, чтобы затем собраться в нижней чаше. Верх – свет, низ – тьма; верх – небо, низ – подземелье. Ромб перечеркивается пополам малой диагональю-поперечной линией – землей. Поэтому в представлении древних земля плоская. Ромб сам по себе есть замкнутое пространство, в котором сколько излилось света сверху, столько же его получили внизу. Ромб не вписывается в колесо, он обводится овалом. Линейная развертка его вращения – зигзаг ɅɅɅɅ… Такая развертка принята в иудаизме, она подчеркивает, что свет извечен. Он просто скрыт тьмой («облаками и туманами». «и тьма была окрест его»).
Для создания единой картины мироздания («рог-гор») следует объединить «косой крест» и ромб. Получаем символ «ромб, перечерченный косым крестом», который у буддистов становится «буддистским крестом», а у славян символом Сварога, или рожденного света. Но еще до буддистов и славян этот символ имел вполне определенное значение. Действительно, «косой крест» и ромб имеют общую единую точку вращения, в которой пересекаются большая и малая диагонали ромба. Но вращение колеса не сочетается с вращением овала, поэтому вместо колеса обычно рисуют квадрат, так как косой крест – его диагонали. «Косой крест» делит ромб на четыре одинаковых малых ромба. Если каждый из них перечеркнуть косым крестом, то он разделится еще на 4 ромба и т.д. И в каждом ромбике появляется своя центральная точка – пересечение диагоналей, через которую проходит ось вращения. Все колесики организуются в систему когерентных циклов.
Деление ромба имеет предел. Этот предел называется «неделимая точка», или а-том. Множество атомов, однородных неделимых точек, и есть в понимании греков «хаос». Атомы собираются в молекулы, молекулы распадаются на атомы. Так реализуется основной закон «собирание-разбрасывание», «соединение-разъединение», «созидание-разрушение». Собранный из одинаковых атомов ромб – структура, ледяная глыба, плод. Ромб, перечеркнутый косым крестом – символ образования плода, поэтому уже в неолите его изображали на животе неолитических красавиц, глиняных женских статуэток. В эпоху неолита неделимые точки называли семенем. Семена подобны звездам на ночном небе, которые собирает месяц («сем-мес»). Археологи называют ромб с точками символом засеянного поля. Тогда статуэтка женщины – мать-земля. А небо-отец осеменяет ее то падающими звездами, то каплями дождя. Вполне подходящая трактовка. Интересно, что греческая Медея засевала поле зубами дракона. Зубы-звезды («зб-зв»), а дракон – летающий змей-зигзаг. Он воплощает время (чередование света и тьмы) и соединяет небо и землю, властвуя над воздушным пространством.



Asterix 15.06.2019 04:06
РОМБ
Часть 2.
Если «косой крест» Х – фигура раскрытая, не имеющая границ, то ромб ◊ закрыт. Верхний угол ромба Ʌ - гора, в пещере которой скрыт огонь. Когда он возгорается, ледяная гора тает. В кресте точка пересечения – преобразователь энергии: сюдсвет сгущается и от нее расширяется. В ромбе такая точка – перекрестье его диагоналей. В знаке Ж вертикальная линия – канал передачи, в ромбе это – главная диагональ. Крест вращается и поэтому вписан в круг, ромб статичен и он вписан в овал. Куда же исходит свет, концентрирующийся в точке перекрестья диагоналей ромба, или пятой точке (4 вершины). Он выходит вовне-рождается в виде плода-сына. Тогда весь ромб в целом – это утроба.
Ромб заполнена водой и тьмой. Тьма-мать, а вода – мать рождающая. Ромб может раскрываться как М – мать, море, Мария и как W – water (вода, англ.), wave (волна, англ.). Мать рождает сына, творца видимого материального мира. Эту символику взяли на вооружение отцы христианской церкви, а выход сына-Христа из пятой точки ромба изображен на иконе «Спас в силах». Спаситель держит в руках свод законов, по которым он намерен устроить видимый мир. Чтобы подчеркнуть, что Христос именно рождается из ромба, была написана икона «Неопалимая купина» (куп-купол-купель-купаться-cup, англ. чаша). Вспомним, что Христос – рыба. Он «плавает» во чреве матери-материи-моря. Приход Христа в мир знаменовал начало эры рыб. Соответственно подобраны цвета, синий и красный: синий – цвет воды, красный – огня. Утроба-ромб должна быть синей, а квадрат, диагоналями которого является «косой крест», красной. Взаимодействия воды и огня – древнейшая тема. На север это взаимодействие воспринималось как таяние снега-льда, когда покой переходил в движение. Талые воды – начало движения. Они стекают с горы. Зигзаги и ромбы, а также остатки культа огня и воды нашли в южно-африканской пещере Бломбос. Как в доисторическую могло возникнуть мировоззрение, общее для русского севера и южной оконечности африканского континента? И все же вода-тьма-мать-покой, а огонь-движение-отец, их взаимодействие – рождение сына-света. Интересно, что чешуя рыб содержит в большом количестве серебристый пигмент гуанин, который поглощает в ультрафиолетовой области, т.е. во тьме вод («вначале была тьма»).
Кстати, любимая икона христиан – «Спас нерукотворный». В точке перекрестья прямого креста, вписанного в круг, помещена голова Христа. Еще раз вспомним, что «рог-гор-гол», а голова с помощью рогов собирает энергию и излучает ее в виде световых (глаз) и звуковых (глас) волн. Впервые прямой крест в круге становится символом арийского бога Праджапати («господин всего»). На иконе «Спас благое молчание» голова Христа помещается в пятой точке ромба, а ромб перекрещен косым крестом. Голова Христа и сам Христос – излучатели света. Крест – атрибут Христа. Он всегда его носит с собой, на кресте его и распинают. Понятно, что он должен нести крест на гору Ʌ, так как он вышел из ее пещеры. Так рождается весеннее солнце. А распятие Христа на горе необходимо для его воскрешения-вознесения на небеса в виде этого самого солнца.
Как умело спрятали отцы церкви языческую символику, ведь ничего нового они придумать не могли! Для того и истребляли язычников, чтобы правда не раскрылась, а на древнем всеобщем мировоззрении легко завоевать мировое господство, слегка перекомпостировав мозги прихожан.



Asterix 15.06.2019 04:08
Копа
"куп-копыто-купол-купель-кипа-cup, чаша" - слово, означающее "собирание". Купель стала куполом, когда стали теряться изначальные смыслы и "рог" поменялся на "гор".
Смыслы терялись, а словп оставались, прочно войдя в обиход и традиции
Копное право
"Копное право — древнейшая форма самоуправления внутри славянской общины, передававшееся из поколения в поколение.
Слово «копа» («купа») — являет собой древний славянский корень, встречающийся в таких словах как «скопом», «совокупность», «скопище», «копна», «копить», «копать» и т. д.
Копа — единство множества; Собрание сходатаев для решения вопросов, связанных с жизнью общины. Копа могла открывать и преследовать преступников, судить и наказывать их, присуждать и доставлять обиженному вознаграждение и, наконец, не допускать нарушения законов Копы. На скопище(собрании) устанавливалась, согласно праву Копы, круговая порука, когда вся община отвечала за проступки своих членов, а также ручалась за безопасность жизни и имущества как своих, так и пришельцев.
Другое название Копы — Громада. Копа собиралась для совещания, то есть на вече. Новгородское Вече — это разновидность городского копного права.
В Копу входило от 4 до 9 близлежащих весей (сёл), сходатаи которых собирались в особом месте («местечке»). Откуда до сих пор сохранилось название главного села (теперь районного центра) — «мисто». Со временем главное село могло перерасти в город, который сохранял в своём управлении Копное право, а его жители назывались мищанами (мещанами).
Правом прийти на Копу пользовались лишь домохозяева, имевшие кроме собственности и постоянную оседлость. Это были Старейшины — Главы Родов. Их ещё называли сходатаи, судьи копные, мужеве, обчие, то есть общинные мужы.
Присутствовали на Копе и Старцы, мнение которых спрашивали в тех случаях, когда нужно было вынести приговор на основании давнишних решений Копы. Однако, старцы и сходатаи — это не одно и то же. Старцы не имели права голоса на Копе, но их советы играли решающую роль. Сыновья и братья, не имевшие отдельных хозяйств, а также женщины являлись в собрание только по особому требованию Копы, как правило, для свидетельских показаний. Правом голоса обладал лишь семьянин то есть тот, который доказал своим образом жизни, что он может упорядочивать пространство вокруг себя. Если у него крепкая семья, здоровое потомство, то это говорит, что у него есть квалификация упорядочивать пространство. Если же человек не имел этой квалификации, то и мнением его пользоваться нельзя.
Копное право основывалось на правиле единогласия — прихода к единому мнению всех собравшихся сходатаев.
Численность Копы могла кол***ся от 100 до 300 человек. Собиралось собрание в центре одного из сёл общины или в заповедной дубраве, в священной роще с естественными или специально нарытыми холмами. Обязательно рядом должны были быть река, пруд, озеро, родник. Это место называлось коповище, копище, капище. Зачастую Копа занималась исследованием и решением спорных и всяких других дел прямо под открытым небом.
Собиралась Копа под звон била, колокола, а также подачей светового сигнала — костра. При уголовном деле Копа вела «распрос», а также искала преступника, устанавливала его «лик» (от этого происходит слово «улика»).
На Копе поощрялось индивидуальное прощение пострадавшим обидчику, а также искренне всенародное раскаяние преступника. Обязательно учитывалось прощение смертельнораненного и его последняя воля, которая считалась законом.
Копа изначально была присуща всем славянским народам. Но с началом христианизации, и заменой общинно-родового уклада на феодальный, она начинает вытесняться сначала из Западной Европы, а потом и с территории Руси.
При Ярославе Мудром на Руси появилась «Русская Правда» — первый писаный уголовно-правовой феодальный кодекс нашей древности. Его аналоги давно уже существовали в Западной Европе. «Русская Правда» всячески защищала интересы нарождавшегося класса феодалов, будущих помещиков. Именно они были первыми гонителями Копы как выразительницы интересов широких слоёв народа.
На Русь с Запада активно начало наступать писаное, Посполитное (польское) право, а также Магдебургское право для больших городов. Принявшие такое «право» жители городов на Копу больше не являлись, а управлялись уже по другим законам. Окрестные сёла произвольно приписывались к такому городу и назывались «околичными».
Вместе с Магдебургским правом на сельские общины начала распространяться и власть помещиков. Поначалу помещик владел землями лишь формально; он собирал налоги, а власть принадлежала Копе. Но под натиском крепостного права Копа перерождается постепенно в сельский суд, на который приглашаются от каждого села по одному сходатаю, а помещик со священником, урядником и несколькими своими приятелями вершат дела так, как им нужно. С 1557 г. помещики получают право даже убивать своих крестьян.
В некоторых местах Копа, будучи всё ещё жизнеспособной, сохранялась, хотя и в ослабленном виде в структурах нового управления. Но сходатаи уже не могли доказать справедливость своих требований, кроме как давностью своего права. Всё чаще помещик говорил: «Я на голое слово мужицкое платить не приказываю». Иногда помещики просто уводили своих крестьян с Копы, а в XVII веке и вовсе запретили им посещать коповище.
Исследованием копного права занимался в середине XIX века Николай Дмитриевич Иванишев, ректор Киевского Университета им. Св. Владимира. Он является автором книги «О древних сельских общинах юга России», где рассказал об основных принципах Копного права, изучая многие тома древних актовых книг.
Изначальность уловить трудно. Зигзаг и ромб как символы огня и воды почитались еще 80 тыс лет назад в Южной Африке. Рисунки и остатки костра с ромбовидными ракушками были найдены в пещере Бломбос. Я проследила движение символов. Они шли с юга на север. Вероятно, у южан были в ходу звуки "гр", тогда как у северных неандертальцев "бл"., те горловые и губные. В словах четко прослеживаются эти два пласта:"гр - горячий" и "бл" - белый.



Asterix 15.06.2019 04:09
РОМБ
Часть 3.
До сих пор мы рассматривали плоское изображение ромба и извлекали заключенные в нем смыслы. Ромб невозможно вписать в колесо, но и у него есть своя ось вращения, проходящая через точку, где пересекаются его диагонали. Точно такая же точка и у квадрата. Однако в квадрате диагонали образуют косой крест, тогда как в ромбе крест прямой.
Квадрат так и остается вписанным в круг или описанным кругом, так как ни одна из его диагоналей (а они одинаковые) не может быть его осью вращения. Диагонали описанного кругом квадрата, становятся диаметрами этого круга и осями его вращения, превращая круг в шар. Шар считался идеальной объемной фигурой, имеющей бесчисленное множество осей вращения. Квадрат же принимает объемную форму куба: 6 граней (2х3), 8 вершин (2 в кубе) и 12 ребер (4х3). В вершине сходятся 3 четырехугольные грани. Ребра, исходящие лучами из вершины, были приняты математиками как 3 основные направления в пространстве – оси x, y , z. В куб можно вписать два тетраэдра (четыре треугольника х 2), октаэдр и икосаэдр, его двойственный многогранник – октаэдр. Таковы объемные конфигурации косого креста.
Прямой крест вторичен по отношению к косому кресту, а ромб вторичен по отношению к квадрату. В отличие от квадрата ромб автономен и не привязан к кругу. Диагонали ромба образуют прямой крест и не равны: главная, вертикальная, диагональ длиннее другой, малой, и являясь осью вращения, трансформирует ромб в два конуса, соединенных круглым основанием и с противоположно направленными вершинами. В круг-основание вписывается квадрат, и вся структура преобразуется в октаэдр. Октаэдр – это две пирамиды, соединенные квадратным основанием. У него 8 граней, 12 ребер, 6 вершин. В вершине сходятся четыре треугольные грани. В октаэдре реализуются те же числа, что и в кубе. Куб и октаэдр – древнейшие модели мироздания.
Квадрат делит октаэдр на две одинаковые пирамиды с противоположно направленными вершинами. Квадрат и косой крест, становятся символами земли. Квадрат разделяет мироздание на объемные структуры надземного и подземного миров, сама же земля плоская и квадратная, ее число – 4. Куб – объемная структура земного мира, место обитания человека. Жилище человека приобретает форму куба, а в центре его, где сходятся диагонали, помещается очаг. Дым столбом проходит сквозь дыру в потолке, устремляясь к небесному очагу – солнцу, соединяя земной огонь с небесным. Понятно, что на кубе помещается пирамида, а крыша должна быть четырехскатной. К основному кубическому «телу» жилища прилагаются «крылья», частью которых является «крыльцо» - малое крыло. Куб вместе с двумя «крыльями» преобразуется в прямоугольник, а крыша удлиняется в одном направлении и становится двускатной. Крыша покрывает куб с крыльями (птица), в котором скрывается тьма, содержащая тепло («пт-тп» - тапас). Тепло возгорается огнем в очаге («ог-аг»).
Три оси x, y , z – ориентировки человека в его земном пространстве. Они задают 6 основных направлений: «вперед-назад», «вправо-влево» и «вверх-вниз». Куб стоит на земле и принадлежит земле. Иное дело октаэдр. Он определяет положение земли в пространстве «вселенной». Вселенная имеет центральную ось, соединяющую вершины двух пирамид: «что вверху, то и внизу». В этих вершинах помещаются источники энергии – дневное и ночное солнца. Верхняя пирамида – день и тепло, нижняя – ночь и холод.
О строении октаэдра как единой модели мироздания мы поговорим в следующий раз.



Asterix 15.06.2019 04:11
Ну ни в заключение нашего краткого и совершенно неполного курса ..

Something Completely Different ...

К вопросу об инсулинорезистентности и кетогенной диете.
Инсулинорезистентность (метаболический синдром) развивается в результате дисфункции жировой ткани, когда ослабевает адипогенез (увеличение количества клеток) и липогенез (накопление жира в отдельной клетке). Морфологически это выглядит как появление мелких адипоцитов. Прогениторы (клетки-предшественники адипоцитов) начинают дифференцироваться в макрофаги, которые сейчас стали называть сенесцентными клетками. Макрофаги секретируют разные факторы, среди которых фактор некроза опухолей (ФНО) альфа. Этот фактор блокирует синтез рецепторов к инсулину в миоцитах (клетки мышечной ткани). Ослабление липогенеза приводит к тому, что прекращается гидролиз триглицеридов, секретируемых печенью (липопротеиды очень низкой плотности). В этом гидролизе участвует инсулин. Нет гидролиза - инсулин не нужен.
Адипогенез стимулируется не триглицеридами, секретируемыми печенью, а пищевым жиром (хиломикроны). При кетогенной диете (производство хиломикрон) происходит активация адипогенеза, что приводит к некоторому "снятию" инсулинорезистентности. НО!!!! Дисфункцию жировой ткани это не устарняет, так как она вызвана другими причинами. Кратковременность эффекта не есть излечение метсиндрома! Метсиндром - показатель дезадаптации системы к возрастному снижению функции жировой ткани. Поеданием жиров дохлую клячу не заставишь вспахивать десятину. Как ни бей ее кнутом!!!



Рекрут 15.06.2019 12:23
Прекрасный обзор Астерикса в духе Вашкевича. Но Астерикс далеко отдалился от ДНК и от ген. кода. Моя "эзотерика", если ее соотнести с лекцией Астерикса и Вашкевичем, действительно приобретает некоторые черты эзотерики.
Порассуждаем о цифрах 2 и 3, лежащих, как он напоминает, в основе мироздания. Добавил бы к этому проекцию на ген. код, который в основе биомироздания. Причем здесь ген. код? А вот в чем. В кодонах 2 и 3 и 1 творят нечто, приводящее к фрактальности сознания, идущего от разумной игры 2 и 3 и 1 в ген. коде. Первые 2 нуклеотида в син кодонах не участвуют в шифровании аминокислот. Третий же (1) - вобулирует, случаен по Ф.Крику (и по правде), т.е. ВИРТУАЛЬНО может быть любым. Виртуально потому, что реально заменен быть не может, поскольку это приведет к замене аминокислоты, что в норме не допустимо. Итак, для биомироздания тройки син кодонов - база для устойчивости ген. информации - избыточность кодирования, изоакцепторные тРНК. Но Природа динамична и организмы должны приспосабливаться к этому, меняя набор имеющихся белков. Пример тому - иммуно глобулины (вспоминаем графики Ву-Кэбота). Посему переходим в мир кодонов не синонимов, которые назвал 'сиом-кодоны' - гибриды син кодонов и омоним-кодонов https://www.scirp.org/journal/PaperInformat...x?PaperID=85202 ( https://www.scirp.org/journal/PaperInformation.aspx?PaperID=85202 ) . Тут уже иные, смысловые (приспособительные) мотивы возникают на базе 2 и 1. 2 - это кодирующие первый и второй нуклеотиды сиом. Третий-то вобулирует и может и ДОЛЖЕН быть любым. НО это должествование достигается НЕ СЛУЧАЙНО (не по Крику), а за счет СМЫСЛОВОГО ДЕЛЕГИРОВАНИЯ значения другой БУКВЫ, берущегося из КОНТЕКСТА мРНК. Приер такой семантико-лингвистической ситуации: "Я забыл коГ своего компа". Читающий это из контекста ПОНИМАЕТ, что в в слове коГ надо заменит Г на Д. То же делает рибосома, как нано биокомпьютер, и ВИРТУАЛЬНО заменяет ТРЕТЬЮ, ЕДИНИЧНУЮ БУКВУ в сиоме на нужную по смыслу. То есть неправильня (единичная) буква перекодируется на правильную. И
И вместе с этим сиом кодон (ТРОЙКА) приобретает ЕДИНИЧНЫЙ и точный смысл. Что здесь происходит? Игра смыслов чисел 1, 2, 3. Вот вам и эзотерика. Это проявление фрактальности сознаания и мышления в биосистемах. Высшая форма, смысловая размерность фрактальности - в геноме нейронов коры головного мозга Человека. https://ss69100.livejournal.com/1395594.html ( https://ss69100.livejournal.com/1395594.html )



vb 15.06.2019 14:10
Если бы я не знал, что петр петрович просто отрабатывает номер нукообразности для своих магических дисков, то подумал, бы что у чувака шизофрения.
а так в принципе, все понятно - городи любую чепуху, главное запятые ставь.



Рекрут 15.06.2019 15:15
(vb @ 15.06.2019 15:10)
Ссылка на исходное сообщение  Если бы я не знал, что петр петрович просто отрабатывает номер нукообразности для своих магических дисков, то подумал, бы что у чувака шизофрения.
а так в принципе, все понятно - городи любую чепуху, главное запятые ставь.

Ставим запятую после vb, перелистываем
и думаем дальше.
Астерикс, а не рассмотреть-ли пирамиду Хеопса как пример архитектурной эзотерики опять-таки с направленностью на генкод. 4 угла в основании и вершина образуют 4 триплета. Кодирующие 4 двойки в основании. Вершина - вобулирующий 3'-нуклеотид. Наблюдается из Космоса, как сигнал о наличии жизни с каноническим генкодом.



Asterix 15.06.2019 16:08
Ну вот Петрович , наконец -то вы заговорили нормальным эзотерическим языком и оказались в нужном и соответсвующем вам контексте.

И вот в этом контексте ваша идея по интерпретации генетического кода с позиций лингвистики смотрится вполне здраво. Это настоящая и прекрасная Каббала.
.. А в научном контексте оно смотрится совсем чужеродным элементом , ну то есть просто не соотвествует парадигме научной и соотвественно не может быть воспринимаемо в господствующей в науке системе детерминизма.

Идею с пирамидой очень одобряю. Красивая интерпретация триплета и генкода. это классика Сакральной Геометрии.

Можно еще с догматом Троицы соотнести, Третья позиция в кодоне как Дух Святой... он тоже воблирует и непостижим. Но без него Троица не обладает силой.



banned sceptique-NMRguy 15.06.2019 16:28
(vb @ 15.06.2019 15:10)
Ссылка на исходное сообщение  Если бы я не знал, что петр петрович просто отрабатывает номер нукообразности для своих магических дисков, то подумал, бы что у чувака шизофрения.
а так в принципе, все понятно - городи любую чепуху, главное запятые ставь.

Я, когда был студентом, купил даже его книгу "Волновая генетика" или что-то в этом роде. Дальше третьей страницы продвинуться не смог, так как доказательств явления там просто не было. Было похоже на поехавший чердак (наши кафедры генетики были того же мнения, но их свидетельств мне было не совсем достаточно, так как у них мог быть скрытый конфликт интересов). Я по этому поводу пошёл посовещаться на уважаемую лично мной кафедру Философии. Там мне одна дама на прямой вопрос слышала ли она о гаряевщине ответила что не только слышала, но и её подруга даже была лично знакома с сим субъектом по работе короткое время, и пряча глаза довольно грустно заметила, что мне лучше не книгу читать, а познакомиться лично с аффтаром, тогда, мол, у меня все вопросы отпадут. Заметьте, это человек с кафедры Философии посоветовал. После этого книжку я выкинул и всё стало понятно.

А сейчас видно, что часть поехавших не осталась, а уехала, но при этом прекрасно ладит друг с другом.



Рекрут 15.06.2019 18:26
(Asterix @ 15.06.2019 17:08)
Ссылка на исходное сообщение  Ну вот  Петрович , наконец -то вы заговорили  нормальным эзотерическим языком  и оказались в нужном  и  соответсвующем  вам контексте.

И вот в этом контексте  ваша идея по интерпретации генетического кода  с позиций лингвистики  смотрится вполне  здраво.  Это настоящая  и прекрасная Каббала.
.. А в научном контексте    оно смотрится совсем чужеродным элементом  , ну то есть просто не соотвествует  парадигме научной  и соотвественно не может быть воспринимаемо  в господствующей  в науке системе  детерминизма.

Идею с пирамидой очень одобряю.  Красивая интерпретация  триплета  и генкода. это классика Сакральной Геометрии.

Можно еще с догматом  Троицы  соотнести,  Третья позиция  в кодоне  как Дух  Святой... он тоже воблирует  и непостижим.  Но без него  Троица  не обладает  силой.

".. А в научном контексте оно смотрится совсем чужеродным элементом , ну то есть просто не соотвествует парадигме научной и соотвественно не может быть воспринимаемо в господствующей в науке системе детерминизма."

А вот это непонятно. "Научный контекст" есть суть синоним словосочетания 'правильный контекст'. А если он неправильный. Ведь это удивительный феномен - зомбирования моделью белкового кода Ниренберга-Крика. Тактически он верный, но стратегически ошибочен. В своей монографии 2009г. "Лингвистико-волновой геном. Теория и практика" разжевал эту ошибку, а в статьях уже все точки над i поставил.

https://www.scirp.org/journal/PaperInformat...x?PaperID=57601 ( https://www.scirp.org/journal/PaperInformation.aspx?PaperID=57601 )
https://www.scirp.org/journal/PaperInformat...x?PaperID=85202 ( https://www.scirp.org/journal/PaperInformation.aspx?PaperID=85202 )

вот они на Русском

http://wavegenetics.org/researches/model-g...icheskogo-koda/ ( http://wavegenetics.org/researches/model-g...icheskogo-koda/ )
http://wavegenetics.org/researches/ciomiya...icheskogo-koda/ ( http://wavegenetics.org/researches/ciomiya...icheskogo-koda/ )

Давайте рассуждать с позиции чистой логики. Если уж и вы не поймете, то надеяться на LMP-vb-подобных просто бесполезно. Постараюсь как можно короче.

Берем стандартную колиную таблицу кода (почему ее, а не человеческую считают стандартной...?). Лучше она воспринимается в представлении, немного корявом (я исправил), Ульфа Лагерквиста (см. статьи, что дал). В ней 8 семейств кодонов разбиты на четверки по по первым двум работающим нуклеотидам, а 3-й вобулирующий везде одинаков - это T, C, A, G. И дополнительно разбил на синонимы и сиомы (гибридные по Лагерквисту, хотя омонимию в сиомах он не видел).
Простое соображение, которое мне пришло на биол. ф-те МГУ, на 3-м курсе на лекциях А.С.Спирина, было удивительно простым, но Крик и Ниренберг его не учли или проигнорировали. Один из их постулатов - код однозначен. Кто не согласится? Иначе код неправильный, если не однозначный. А за неправильный Нобеля не дадут. Простое соображение вот какое. Если 3'-нуклеотид в кодонах вобулирует (может быть любым), но вобулировать он может только в воображении (виртуально), ТО для 32 синонимов это верно (на то и изоакцепторные тРНК). А для 32 не синонимов (сиом-кодонов) ЭТО НЕ ВЕРНО. Почему? Потому что семейства сиом кодонов в каждом семейств ВНУТРИПАРНО кодируют одну и ту же аминокислоту но разные для разных семейств. А МЕЖПАРНО - разные аминокислоты. Насчет стопов особый разговор - см. вторую статью. Следовательно, в каждом из семейств сиом кодонов существует НЕ ОДНОЗНАЧНОСТЬ. А этого быть НЕ ДОЛЖНО в соответствии с постулатом однозначности кодирования отцов кода. Мало того, что это следует просто из логики, так группа Ниренберга одним из первых феноменов обнаружила, что кодон UUU кодирует ОДНОВРЕМЕННО фенилаланин и лейцин. То есть постулат однозначности НЕ СОБЛЮДАЕТСЯ. С эти противоречием Ф.Крик и М.Ниренберг справились просто - написали в статье в УФН 1964 г. (приводил сто раз), что "молекулярная природа этого нам не понятна"... Слов нет... , одни гласные звуки. Так что, модель кода Крика-Ниренберга вообще неверна? Верна тактически, а стратегию надо корректировать. Корректировка проста. Омонимические неоднозначности сиом снимаются контекстными ориентациями рибосомы на мРНК, т.е. работает "ВТОРОЙ генетический код" по Л.П.Овчинникову. Что этот код из себя представляет Овчинников почему то не говорит.
Феномен неоднозначности кодирования обнаружила также и группа Туранова в США в 2009 г. Они очень изящно и корректно экспериментально доказали, что кодон UGA реснитчатой инфузории кодирует ОДНОВРЕМЕННО цистеин и селеноцистеин http://molbiol.ru/forums/index.php?act=Att...=post&id=298379 ( http://molbiol.ru/forums/index.php?act=Attach&type=post&id=298379 ) .

В самом общем виде - что все это означает:

1. Белковый код двукратно вырожден по оси синонимии (давно доказано) и по оси омонимии. Это предсказал в своей монографии "Волновой генетический код" (1997 г.). Пока не принято научным официозом. Почему? Не понятно.
2. Работа белок синтезирующей системы (ее кода) есть квази разумный акт, вероятно, вселенского масштаба.

3. Особо: белок синтезирующая система основана не только на текстовой базе, но и на основе математических операций с использованием предельно абстрактного понятия НУЛЯ. (В.И.Щербак). Читайте его статьи. Мой контакт с ним, к сожалению, прерван.



Рекрут 15.06.2019 18:29
ЗЫ: Русские ссылки битые. Буду исправлять. Могу прислать в лички.



banned sceptique-NMRguy 15.06.2019 20:14
Разные тРНК в клетке содержатся в разных концентрациях, потому использование разных триплетов - это управление (термодинамическое) свёрткой результирующего белка, если эта свёртка важна. Как и константой скорости биосинтеза белкового продукта, если его в ответ на активацию транскрипции нужно больше или меньше.

Это даже школьнику сейчас понятно. И активно используется там, где белка нужно побольше, а фолд его не особо важен (биотехнологические оптимизации индуцированного биосинтеза) и все равно впереди рефолдинг ин витро. Оптимизация кодонного состава под организм-продуцент называется в промышленной биотехнологии.

Пётр Петрович, сходите к доктору, не тяните. Пока совсем не спились как третьяков.



Asterix 15.06.2019 20:31
ну друзья , причем здесь доктор ... есть разные парадигмы и платформы ... люди стоящие на разных платформах и продерживающиеся разных парадигм не могут договориться в принципе .

И в Случае Петровича это просто во всей красе-наготе становится очевидно. И вызывает раздражение у истовых ученых ... поскольку таки да , есть разные платформы и разные парадигмы и они друг друга не отрицают. Они существуют параллельно.

И Наука - это всего лишь одна из таких платформ, есть и другие.



banned sceptique-NMRguy 15.06.2019 22:02
Вы там неотрицаете-неотрицаете, а потом как совесть просыпается изредка - сразу или бухать или гаситься, чтобы забыть что вас ждет, неотрицателей толерастичных.

Как и всех "просвещённых эуропэйцыв" вокруг. Смерть и Суд то - не обманешь. А на таких правилах вы играть не готовы окажетесь.



Рекрут 15.06.2019 22:44
(banned sceptique-NMRguy @ 15.06.2019 21:14)
Ссылка на исходное сообщение  Разные тРНК в клетке содержатся в разных концентрациях, потому использование разных триплетов - это управление (термодинамическое) свёрткой результирующего белка, если эта свёртка важна. Как и константой скорости биосинтеза белкового продукта, если его в ответ на активацию транскрипции нужно больше или меньше.

ППГ: ну это примитив. Вы просто не понимаете и не хотите понять то, что кратко изложил выше. Биосинтез белка - это не только физико-химия и термодинамика, которые вторичны. Первичные, стратегические регуляторы  начинаются с работы 3'-нуклеотидов кодонов сиом в организации белкового синтеза, как механизма создания и учета смыслов генов.  Если вы не поняли недоработанность модели кода, то вам уже ничем нельзя помочь. Прочитайте книгу В.В.Налимова "Вероятностная модель языка", может что-то усвоите. И усвойте высказывание акад. РАН Л.П.Овичинникова о "втором ген. коде", работающем на контекстах мРНК, что приводил тут не раз.
Именно вероятностно-контекстные мотивы (ВКМ) являются ведущими в выборе тРНК и смыслов сиом кодонов. ВКМ определяют приспособительную нацеленность в биосинтезе белков, когда организмам необходимо адаптироваться к мобильной внешней среде. Иллюстрацией таких адаптаций, как уже упоминал, служит биосинтез иммуноглобулинов. 

NMRguy: Это даже школьнику сейчас понятно. И активно используется там, где белка нужно побольше, а фолд его не особо важен (биотехнологические оптимизации индуцированного биосинтеза) и все равно впереди рефолдинг ин витро. Оптимизация кодонного состава под организм-продуцент называется в промышленной биотехнологии.
Пётр Петрович, сходите к доктору, не тяните. Пока совсем не спились как третьяков.

ППГ: Хамство и наглость оставьте себе и спрячьте подальше. Стыдно за вас, любезный.




Рекрут 15.06.2019 22:48
(banned sceptique-NMRguy @ 15.06.2019 23:02)
Ссылка на исходное сообщение  Вы там неотрицаете-неотрицаете, а потом как совесть просыпается изредка - сразу или бухать или гаситься, чтобы забыть что вас ждет, неотрицателей толерастичных.

Как и всех "просвещённых эуропэйцыв" вокруг. Смерть и Суд то - не обманешь. А на таких правилах вы играть не готовы окажетесь.

Что за безграмотный и бессмысленный набор слов? Вы пьяны, любезный?



banned sceptique-NMRguy 15.06.2019 23:51
О да, прикиньте, там и на Ваше волновое помешательство будет всем наплевать. А вот за лжецелительные свои подвиги всё же придётся ответить, ох придётся. И в весьма недружелюбной аудитории будут вопросы задавать, ой не в дружелюбной, Пётр Петрович.



Рекрут 16.06.2019 10:34
(Рекрут @ 15.06.2019 23:48)
Ссылка на исходное сообщение  Что за безграмотный и бессмысленный набор слов? Вы пьяны, любезный?

У нас все в порядке. Лицензия есть. Люди, получившие помощь, благодарят. См. отзывы таких людей wavegenetics.org и поднимайте свой научный уровень. И ведите себя достойно на форуме.



LMP 16.06.2019 11:26
опять сам с собой разговариваешь? что курил, признавайся



Рекрут 16.06.2019 17:58
(Asterix @ 15.06.2019 21:31)
Ссылка на исходное сообщение  ну друзья , причем здесь доктор ... есть разные парадигмы  и платформы ... люди  стоящие на разных платформах    и продерживающиеся разных парадигм  не могут  договориться  в принципе .

И в Случае Петровича  это просто  во всей красе-наготе  становится очевидно.  И вызывает раздражение у истовых ученых  ... поскольку  таки да , есть разные платформы и разные парадигмы  и они  друг друга не отрицают.  Они существуют параллельно.

И Наука  - это всего лишь одна из таких платформ,  есть и другие.

Астерикс, вы профи в мол. биологии, тем более плотно работаете с белок синтезирующей системой. Может, я в своих теор. выкладках, относительно ген. кода, неправ. Был бы очень признателен, если дадите какой-либо комментарий. А история ваша с лейцином и др. фокусами, очень показательны по отношению к просчетам офиц. модели ген. кода.



Asterix 16.06.2019 18:39
Петрович , ваш теория принадлежит эзотерической платформе знания, и уходит корнями в Древний Египет и к Пифагору который принес это тайное знание из Египта в Грецию.

Это теория струн и волновая природа материального мира. Вы применили это древнее знание к генетике , в частности создали теорию генетического кода которая основана на воззрениях древних ученых. Это такая древняя генетика.

Мне ваша теория совершенно понятна и ясна и я изучал эзотерику и у меня тоже есть эзотерические проекты которые я маскирую под научно-художественную деятельность.

Современная наука вышла из эзотерического комплекса дисциплин и конечно же элементы эзотерики в ней остались. Но это не дает возможности использовать научный метод для доказательства или опровержения эзотерический теорий.

Поэтому обсуждать Волновую генетику я могу только с эзотерический позиций но никак не с научных.

Ничего неправильного я в нею не вижу ... Добротная эзотерика. Если бы вы пользовались соответсрцующим языком то вообще прекрасно бы было ... эта научная терминология только раздражает и вводит в заблуждение читателя.

Вы бы написали в качестве первого тома - введение в сакральную геометрию и обьяснили бы терминологию и во втором томе плавно бы перешли к Волновой Генетике. И странных вопросов у читателей бы уже не возникало. Все бы встало на свои места и логика ваша стала бы понятна.


Впрочем вот у физиков давно когда-то получилось принести древние эзотерические концепты дуализма волна-частица в науку .. Но там же вначале были эксперименты которые просто вынудили отказаться от детерминизма.

Вы же пока никакого убедительного эсперимента не поставили. Ну есть некая неопределенность в коде , в каких-то особых случаях, которая ни на что практически не влияет. И никакой необходимости использовать Волновую Генетику в своей работе я не вижу. Меня совершенно устраивает классичесяя модель ДНК-кода.

Я вижу в работе некие интересные эффекты на уровне генома, возможно они имеют волновую природу , что впрочем неудивительно ... но не на уровне гена.

На уровне простой инженерии генов у меня нет вопросов к кодированию аминокислот.



Asterix 16.06.2019 18:57
Ну вот вы пишете -

2. Работа белок синтезирующей системы (ее кода) есть квази разумный акт, вероятно, вселенского масштаба.

Ну это же очевидно сразу что ваша теория не относится к науке и критике не подлежит. Наука не использует фактор Бога, это принципиальное ее отличие от эзотерики и от религии.

Ну вот вамн задание , придумайте четкий эксперимент с заменой кодонов согласно вашей теории.
Могу даже подсказать.. Дело в том что есть такое дело , сканирующий мутагенез белка. Это когда аминокислоты по порядочку заменяют на аланин скажем или лейцин. И вот такое удивительное дело , большинство замен очень слабо влияют на функцию белка, и мутанты вполне функциональны.

С позиций вашей теории рибосома должна корректировать эти замены и вставлять в белок правильные аминокислоты руководствуясь какими-то инструкциями скрытыми в генкоде Вышим Разумом Вселенной.

Ну и так далее ... рельсы я поставил , далее надо паровоз на них поставить, то есть практический эксперимент придумать .. который докажет или опровергнет эту гипотезу основанную на вашей теории.

Понадобится синтез генов-мутантов с заменами кодонов согласно вашей схеме , система клеточной или бесклеточной трансляции, и анализ белкового продукта на наличие или отсуствие ожидаемой аминокислотной замены. Ну и нужна статистика ... единичный случай в науке ничего не решает.



Vadim Sharov 16.06.2019 19:01
Тут один тощий дрищ посетовал, что меня в "Беседе" мало, пришлось снизойти на просьбу.
Мой взамнонелюбимый друг, снимаю шляпу. Могёте же! Вот он долгожданный стиль Франкенштайн. Никаким португальским белым не пропьешь талант. Что тут мелочиться талантище!!! И это без стёба, разве что на миниглоток портвейна. Что ж Вы раньше то скрывали. Так и хочется посмотреть на Ваших фламандских муз. Впрочем, лучше вы к нам. Дары моря с вином пошлость (нет, конечно, портвейн португальский ого-го, но в Генте в японском ресторане, брр) , обещаю молодого кабанчика на вертеле под сербскую ракию.



Рекрут 17.06.2019 12:05
(Asterix @ 16.06.2019 19:39)
Ссылка на исходное сообщение  Петрович  , ваш теория  принадлежит  эзотерической платформе  знания, и уходит  корнями  в Древний Египет   и к Пифагору  который принес  это тайное знание  из Египта  в Грецию.

Это теория струн  и волновая природа  материального мира.  Вы применили  это древнее знание  к  генетике , в частности создали  теорию генетического кода  которая основана на воззрениях древних ученых.   Это  такая  древняя  генетика.

Мне ваша теория совершенно понятна и ясна   и я изучал эзотерику  и у меня тоже есть эзотерические проекты которые  я маскирую под  научно-художественную деятельность.

Современная наука вышла  из эзотерического комплекса  дисциплин   и  конечно же  элементы  эзотерики в ней остались.  Но  это не дает  возможности  использовать научный метод  для  доказательства   или опровержения эзотерический теорий.

ПГ: особенно квантовая физика вышла из эзотерики. Ярко об этом Доронин написал в своей книге "Квантовая магия" (есть в сети). А сам он физик высокого уровня. Работает с проблемами квантового компьютинга. То есть его эзотерические мотивы не мешают ему профессионально работать. Особенно эзотерично влияние сознания на поведение элементарных частиц, напр, при дифракции электрона на двух щелях одновременно. Вот она квантовая нелокальность, которая, предполагаю, играет свою роль в геноме, нелокально распределяя его информацию по миллионам клеток биосистем. Удобно и объясняет много необъяснимого в генетике. 


Ас: Поэтому обсуждать  Волновую генетику я могу только с эзотерический позиций  но никак не с научных.

ПГ: А вот это зря. Вы и Эйнштейна будете упрекать за его отсылы к Богу, напр., "Бог не играет в кости"...

Ас: Ничего неправильного я в нею не вижу ... Добротная эзотерика.  Если бы вы пользовались соответсрцующим языком   то вообще  прекрасно бы было ... эта научная терминология  только раздражает и вводит  в заблуждение  читателя.

ПГ: Почему? Я же использую ее для расширенного понимания функций сиом кодонов. Куда же тут без научных терминов?

Ас: Вы бы написали  в качестве первого тома  - введение в сакральную геометрию  и обьяснили бы терминологию   и во  втором томе плавно бы перешли к Волновой Генетике. И  странных вопросов у читателей бы уже не возникало.  Все бы встало на свои места  и логика ваша стала  бы понятна.
Впрочем вот у физиков давно когда-то получилось принести  древние  эзотерические концепты  дуализма  волна-частица  в науку .. Но там же  вначале  были  эксперименты которые просто  вынудили отказаться от детерминизма.

ПГ: Так об экспериментах и шишу и осуждаю. Чего стоят фантомные листовые  эффекты? И  фантомы  ДНК, предсказанные А.Г.Гурвичем и  обнаруженные нами и, аналогичные, Нобелиатом Люком Монтанье? А значимость (стоимость) их велика. Они-то и говорят о нелокальности ген. информации. Что, отказаться от фактов в угоду шараханья от эзотерики? 

Ас: Вы же пока никакого убедительного эсперимента не поставили. Ну есть некая неопределенность в коде , в каких-то особых случаях, которая  ни на что  практически не влияет.   И никакой необходимости  использовать  Волновую Генетику в своей работе я не вижу.  Меня совершенно устраивает классичесяя модель ДНК-кода.

ПГ: Поставили. Напр. при материализации фантомной ДНК в ПЦР системе (то же сделал Л.Монтанье). Или, напр., при квантовых  дистантной регенерации поджелудочной у крыс, регенерации зубов у собаки и человека, регенерации и заживлением тканей при терминальных стадиях диабет. язвы стопы.

Ас: Я вижу в работе некие интересные эффекты на уровне генома, возможно они имеют волновую природу , что впрочем неудивительно ... но не на уровне гена.

ПГ: именно на уровне генома - голографические эффекты с фантомным листовым эффектом и дистантной квантовой трансляции пулов работающих генов, участвующих в регенерации поджелудочной железы. Наши эксперименты в Торонто, Москве и Н.Новгороде. Опубл. в ВАКовском журнале (БЭБиМ) в 2007г. Защищена подтверждающая кандидатская Николаем Кокая, утвержденная ВАКом в 2012г.

Ас: На уровне простой инженерии генов у меня нет вопросов  к   кодированию аминокислот.

ПГ: Она иллюзорно простая и ведет к ошибкам, поскольку не учитывает лингвистическую составляющую, связанную с функциями сиом кодонов. 




Asterix 17.06.2019 15:31
Ну Петрович . я все это понимаю прекрасно, я же тоже вкалываю себе ДНК от других видов и наблюдаю на себе интересные эффекты очевидно волновой природы.

И еще мы делаем клинические испытания моей [ Dream-Machine] особой терапии под видом искусства. Которая тоже оказывает мощнейшее воздействие на наших человеко-кроликов. Я в прошлый раз очень далеко на ней улетел, просто сломался регулятор мощности и я соединил напрямую то есть поставил на максимальную мощность... Уффф.. теперь так и будем делать ... это было что-то необычное. Кстати видел опять модель ДНК, ту же самую которую Крик видел. Она в том мире существенную роль играет.

И я сразу могу сказать что никакого плацебо-контроля в моих экспериментах не может быть в принципе ... Потому что сознание здесь играет наисущественнейшую роль. На животных я тоже не могу ничего показать . Только на людях это работает. Ибо еффект идет через мозг , а это очень магический орган у человека. Вообщем Эзотерические есть у меня проекты.. вроде ваших .

Ну а с материализацией ДНК в ПЦР реакции ... лучше не надо... это вызывает мощное недоверие у коллег. У наших студентов чего только в пробирках не материализуется.. Ну нельзя же все обьяснять Высшим Разумом.

Приложение на английском

https://youtu.be/CZ1fvFbAcoA ( https://youtu.be/CZ1fvFbAcoA )

The human brain is often conceptualized as a supercomputer of cosmic complexity, and like all main frames, it can be hacked into and hijacked for a range of different purposes. Getting high is the most popular of these, as evidenced by the ever-increasing rates of global drug use. Fortunately, no one has to hide anything up their bottom for you to join in the fun, as there are a number of much geekier ways to enter an altered state of consciousness without the use of drugs. The Broadband Squish The experience known as "reality" is actually just a trick that our brains play on us, by carefully filtering the sensory information that the world presents to us in order to generate a workable perspective on things. The parameters of our consciousness can therefore be modified by destabilizing these finely tuned filters, and one way to do this is by altering their electrical signals, or brainwaves. Depending on what you want to feel, you’ll need to choose carefully from the menu of different brainwaves and their associated effects. Theta waves, for example, have a frequency of 4 to 8 Hz and are linked to intuition, but can also lead to excessive daydreaming when they are too high in amplitude.



Asterix 17.06.2019 15:41
Вот наш предтеча.. австрийский проект .. кстати я был реально удивлен когда один из создателей этой Люции, Дирк Прукл , на самой первой ее презентации в Рочестере сразу же спросил меня про Гаряева и его волновую генетику... Оказывается у него есть похожие идеи тоже.

[The Lucia N°03 provides a deep nervous system relaxation while simultaneously providing a unique transcendental journeying experience. For the first time even novice meditators experience a state of deep relaxation coupled with focus, where one is in touch with their own intuition and sense of wholeness. White light passes through closed eyelids, past the retina to the pineal gland, and creates a visual experience of one’s own design. The inner consciousness of the traveler produces scenes of indescribable beauty. Music enhances the experience as the mind combines the two stimuli, generating synesthesia – the experience of seeing music. Faced with the artistry of ones own inner consciousness, light travelers cannot help but to re-evaluate their perception. Each experience is as unique as the person in the light." Charna Cassell will be displaying the only Lucia No.3 System available in the Bay Area.

http://www.lucialightexperience.com/ ( http://www.lucialightexperience.com/ )



Asterix 17.06.2019 15:58
вот мой первый эксперимент с ДНК само-иньекцией.. башку потом снесло офигительно интересно. такие эффекты глубокие .

yes we do ....
https://youtu.be/vEV44ds9lOI ( https://youtu.be/vEV44ds9lOI )
Spider DNA DIY self-injected in Vladimir Kai who becomes the first European human-spider chimeric organism .



Рекрут 17.06.2019 19:52
Эх жаль, стерся мой развернутый ответ. Но суть его проста. Можно получать голографические образы от введенной чужеродной ДНК, попадающей в нейроны коры гол. мозга. Можно дешифровать ЭЭГ и реализовать телепатию на основе возникающих тексто-образных структур генома нейронов гол. мозга и эпифиза (пинеальной железы). Образы, даваемые ДНК, мы получали из мШЭИ спинтронных спектров её. Хотел прикрепить картинки этих образов как avi файлов, но они большие, не крепятся.



Рекрут 17.06.2019 19:55
Но круто все заворачивается с инъекциями чужеродной ДНК. И работает на лингвистико-волновую генетику.



banned sceptique-NMRguy 17.06.2019 19:56
Больные наркоманы



Рекрут 17.06.2019 20:33
(Asterix @ 17.06.2019 16:31)
Ссылка на исходное сообщение  Ну Петрович . я все это понимаю прекрасно, я же тоже вкалываю себе ДНК  от других видов  и наблюдаю на себе  интересные эффекты  очевидно волновой природы. ,

Ну а с материализацией ДНК  в ПЦР реакции ... лучше не надо... это вызывает мощное недоверие у коллег. У наших студентов чего только в  пробирках не материализуется.. Ну нельзя же все обьяснять Высшим Разумом.

Высший разум, Бог-творец. Спиноза дал гениальную формулу. Природа есть причина самой себя (causa sui). Она сама себе Творец. Вообще, Природа, Космос есть реализованные (овеществленные) семантические структуры. То есть в начале был Знак, как порождение Сознания Вселенной, которое материализовалось. То же у Гегеля с его Абсолютной идеей.

А скепсис насчет ПЦР фантомов (Квантовых Эквивалентов (КЭ) ДНК, предсказанных А.Г.Гурвичем), это вы зря. Просто надо чисто работать и ставить множество контролей. И не студентам это давать, а сами делать. Тогда получите воспроизводимые материализации КЭ ДНК. Предлагал тут повторить наши эти эксперименты, нашу статью, протокол дал. Бесполезно. Не слушают. МММ, было, вызвался, но убежал в кусты. И еще раз. Разберитесь с фокусами с лейцином. Это происки лингвистической составяющей Кода.

Шарову. Идея проверки хорошая, но она игнорирует смысловую компоненту мРНК. Можно проще доказать неполноты модели Кода. Надо найти случаи несоблюдения коллинеарностей кодонов мРНК и кодируемых аминокислот на больших белкАх.

Косвенно это следует из экспериментов с геном HotHead у Арабидопсиса, когда Лолли и Прюит в 2005г. в Science показали что этот ген может давать различные морфогенетические эффекты в зависимости от положения в геноме растения. То есть от контекста последовательностей с 3' концов 5' ДНК. Иными словами, один из триплетов мРНК, оставаясь неизменным, кодировал разные аминокислоты, что давало разные белки и, соответственно, морфогенезы. Бедные Лолли и Прюит этого не поняли и были задавлены обвинениями в загрязняющем кроссинг переносе пыльцы между разными Арабидопсисами (мутантными и дикими). Сюда же относится работа группы Туранова (цитировал), когда один и тот же кодон UGA реснитчатой инфузории кодирует одновременно цистеин и селеноцистеин. А это против священной Модели Кода.smile.gif



Asterix 18.06.2019 01:06
Петрович , ну давайте таки стоять на одной платформе , на эзотерической , где Высший Разум рулит все ..

Не надо мешать этот коктейль из эзотерики и науки.. Он ничего кроме похмелья тяжелого не дает.



Рекрут 18.06.2019 08:41
(Asterix @ 18.06.2019 02:06)
Ссылка на исходное сообщение  Петрович , ну давайте таки стоять на одной  платформе , на эзотерической , где Высший Разум рулит  все ..

Не надо  мешать этот коктейль  из эзотерики и  науки.. Он ничего кроме похмелья тяжелого не дает.
'
Мешай - не мешай, а от факта 'эзотерика научна, а наука эзотерична' не уйдешь. Пропорции меняются в разных направления мыслей (исследований). В квантовой физике преобладает эзотерика, в биологии - наука. В генетике поровну того и другого. Мне больше по душе эзотерика генетики. За ней будущее и здоровье людей. И библейское долголетие.



Рекрут 18.06.2019 11:19
Астерикс:

"Ну вот вам задание , придумайте четкий эксперимент с заменой кодонов согласно вашей теории.
Могу даже подсказать.. Дело в том что есть такое дело , сканирующий мутагенез белка. Это когда аминокислоты по порядочку заменяют на аланин скажем или лейцин. И вот такое удивительное дело , большинство замен очень слабо влияют на функцию белка, и мутанты вполне функциональны.

С позиций вашей теории рибосома должна корректировать эти замены и вставлять в белок правильные аминокислоты руководствуясь какими-то инструкциями скрытыми в генкоде Высшим Разумом Вселенной.

Ну и так далее ... рельсы я поставил , далее надо паровоз на них поставить, то есть практический эксперимент придумать .. который докажет или опровергнет эту гипотезу основанную на вашей теории."

ПГ: "слабо влияют" - это уже хорошо. Но если принять идею, что мРНК и кодируемые ею гены - реальные слова со своими смыслами, а их сочетания - речеподобны, то вот вам пример, говорящий о недостатках предлагаемого эксперимента с заменами аминокислот (хорошо бы ссылку!). Представьте себе, множество изоферментов, нуклеазы,к примеру кодируются несколькими генами (словами на непонятном пока нам языке). Функция нуклеаз - резать нуклеотидные последовательности. Допустим есть и ген. слова-вариации слова "резать" и соответствующие им мРНК и гены. На выходе имеем набор нуклеаз, слегка различающиеся по последовательностям аминокислот, но активные центры этих ферментов, как известно, одинаковы. То есть различия последовательностей аминокислот в нуклеазах - справа и слева от активного центра. Так? Так. Смотрим на корень белкового слова "резать". Этот корень "РЕЗ". Теперь смотрим синонимы слова резать - врезать, подрезать, резня, резальщик, порезать, вырезать, вырезка и т.д. Корень у них один, справа и слева приставки и окончания разные, тоже своего рода контексты, тонко меняющие смыслы "изослов", хотя основной ГЛАВНЫЙ смысл биохимических операций изоферментов нуклеаз один и тот же. Также как изослов-синонимов с корнем РЕЗ.
Отсюда и получается, что замены аминокислот ВНЕ активного центра разных нуклеаз не меняют стратегию механизма их работы, но меняют тактику - "резня" полинуклеотидов происходит в их разных местах и с разными темпами. Что не затрагивает их основную задачу.
Интересно, авторы цитируемой вами статьи, заменяли аминокислоты в активных центрах изозимов? Поэтому и прошу у вас точную ссылку на их работу.

Насчет "Высшего разума вселенной". Вопрос старый и фундаментальный. В.В.Налимов, крупнейший наш философ, с которым имел счастье беседовать, в своей монографии "Спонтанность сознания" обосновывал идею, что Вселенная СЕМАНТИЧНА, построена на ИДЕЕ (Гегель) и реализуется в материализации ИДЕИ, в том числе в форме слов и речи.

Астерикс, можете прямо ответить мне: Вы видите кардинальную ошибку в модели ген. кода, что дали отцы ее - М.Ниренберг и Ф.Крик? Видите ее двукратную синонимо-омонимическую вырожденность? Да или НЕТ?

И второй вопрос: считаете-ли Вы, что Спиноза прав, сказав, "Природа есть причина самой себя"? То есть Природа = Бог.



Рекрут 18.06.2019 13:43
Вот не битые ссылки на расширение модели генетического белкового кода. Русские варианты.

http://wavegenetics.org/researches/model-g...icheskogo-koda/ ( http://wavegenetics.org/researches/model-geneticheskogo-koda/ )
http://wavegenetics.org/researches/ciomiya...icheskogo-koda/ ( http://wavegenetics.org/researches/ciomiya-geneticheskogo-koda/ )



Asterix 18.06.2019 14:17
Петрович,

Ссылку я дать не могу поскольку это я сам придумал за 5 минут, навскидку , специально для Вас, это черновик, вам предлагается написать подробный детализированный эксперимент который бы показал вашу правоту или не показал . Это называется научный подход , в эзотерике подобные вопросы не задают и эксперименты не ставят, там подход к мирозданию холистический, не требующий никаких экспериментов вообще.

У вас есть идея по поводу генетического кода .. мол не так все кодируется как в классической модели.. Код имеет волновую природу , там есть интерферренции , неоднозначности , и прочие магические явления как в Квантовой механике с ее непостижимыми элементарными частицами.
Но там есть таки отмазка что при всей непостижимости электрона мы таки пользуемся электричеством и есть формулы которые описывают поведение его и на этих формулах базируются технологии и практические применения электрона.

Вот я предложил вам показать как можно увидеть вашу правоту экпериментальным образом.

нарисуйте два гена согласно вашей теории и давайте их экспрессируем в бактериях и увидим что ваши предсказания работают, а классическая модель не работает.
Только не надо про селеноцистеин, там есть совершенно обычный механизм, никакой эзотерики.
Ну и не надо обращаться к ошибкам трансляции, да рибосома может ошибаться и вставлять другие аминокислоты , так же как и синтез ДНК и РНК тоже происходит с ошибками. Но это все редкости , а нам нужна 100% воспроизводимая ситуация , которую можно в любой лаборатории проверить и воспроизвести.

Давайте отделим эзотерику от науки... Это разные платформы мировоззренческие.



Asterix 18.06.2019 15:22
вот в качестве метафористического текста ... , перерыв в беседе. на обед.

КОКА-КОЛА С НЕБА
( пути к богатству исповедимы)
На Startup Village в Сколково, смертельно скучая на панельной дискуссии по умным городам, я поинтересовалась у зала ( довольно полного, к чести организаторов, более 200 человек):
- А вы чего все сюда пришли? Ведь одно и тоже говорят вот уже лет 10! Без изменений. Кто из вас пришел, чтобы понять, как стать миллионером/ миллиардером?

Поднялось 80% рук. То есть здоровая пассионарность и жадность в людях присутствует, они просто ищут информацию и партнеров, вот и тратят деньги на всяческие тусовки. А вдруг?!
Этим 80% посвящаю сие нехитрое размышление.

Резкий переход к богатству обеспечивают - религия и карго-культ. В религии конечно выбираем каббалу. Каббала прямо, без обиняков, занимается вопросами первичного накопления капитала, не без последствий, конечно.
Мой любимый писатель, Пелевин, постоянно пролетающий мимо больших денег в реальной жизни ( судьба всех гениев), но очень стремящийся к достижению стабильного финансового состояния, изучал этот вопрос в "Графе Т":
" Скоты оплодотворяют друг друга, а затем рождается новое животное, для существования которого уже не требуется, чтобы его, так сказать, зачинали секунда за секундой. Перенеся это наблюдение на высшие сферы, люди древности решили, что и там действует тот же принцип. ... Официально Бог один, однако скрытое эзотерическое ответвление каббалы хорошо помнит, что творцов на самом деле много и всех нас создают разные сущности. Складывая буквы и слова, он приводит в содрогание божественный ум и вынуждает Бога помыслить то, что он описывает..."
Ну, то есть он пришел к выводу, что все это оху..нно сложно и перенасыщенно деталями.

Зато карго-культ или культ Даров небесных, в дальнейшем, с лёгкой руки Ричарда Феймана, называемый культом Самолетопоклонников - вещь простая, практичная, много раз использованная на практике. Расцвел он во Вторую Мировую Войну на островах во время Тихоокеанской компании. Американские самолеты сбрасывали на парашютах своим солдатам и туземцам всякие классные вещи: жратву, одежду и т.п. Потом война кончилась лагеря свернули и самолеты улетели. А тузмецы подумали, подумали, как вернуть сытую, цивилизованную жизнь и...
".. Чтобы получить товары и увидеть падающие парашюты, прилетающие самолёты или прибывающие корабли, островитяне имитировали действия солдат, моряков и лётчиков. Они делали наушники из половинок кокоса и прикладывали их к ушам, находясь в построенных из дерева контрольно-диспетчерских вышках. Они изображали сигналы посадки, находясь на построенной из дерева взлётно-посадочной полосе. Они зажигали факелы для освещения этих полос и маяков. Приверженцы культа верили, что иностранцы имели особую связь со своими предками, которые были единственными существами, кто мог производить такие богатства..."

Наша верхушка уже сильно продвинулась на этом пути. Смотря много голливудских фильмов, они обнаружили, что если ты вылезаешь из личного Falcon в джинсах и кедах, а за тобой скачет штат assistants, которые привели тебе ламу к трапу, чтобы создать настроение перед переговорами, то ты совсем как Илон Маск.
А если на ваших мероприятиях есть панельные дискуссии и там говорят на английском языке и крутятся видео, то это значит, что экономика бурлит и вот, вот посыпятся американские товары с неба. ( На ИТ-завтраке на ПМЭФ так и было сказано в заключительной реплике, при молчаливой поддержке Минсвязи:
-... заканчивайте это ваше импортозамещение с колесоизобретением, надо покупать и внедрять зарубежные продукты и сервисы, а то отстанем...).

Островитяне в кокосовых наушниках ждут американских консервов и одеял уже 72 года. Ну и у нас впереди вечность.

"...— Если ты хочешь понять, что такое человеческая культура, вспомни про жителей Полинезии. Там есть племена, обожествляющие технологию белого человека. Особенно это касается самолетов, которые летают по небу и привозят всякие вкусные и красивые вещи. Такая вера называется "карго-культ". Аборигены строят ритуальные аэродромы, чтобы, так сказать, дождаться кока-колы с неба..."



Рекрут 18.06.2019 16:17
(Asterix @ 18.06.2019 15:17)
Ссылка на исходное сообщение  Петрович,

Ас: Ссылку я дать не могу поскольку  это я сам придумал  за 5 минут,  навскидку , специально для Вас, это  черновик,  вам предлагается написать  подробный детализированный эксперимент  который бы показал вашу правоту  или не показал .  Это называется научный подход ,  в эзотерике  подобные вопросы не задают  и эксперименты не ставят,  там подход  к мирозданию  холистический, не требующий никаких экспериментов вообще.

ПГ: давайте холистический. Он на чистой логике с малой примесью экпериментальной практики. Это о заблуждениях о коде. В модели явный прокол. Просто посмотрите на не син кодоны в Таблице. Они кодируют неверно. Почему, объяснял выше. Ну опровергните меня без экспериментов, разумно рассуждая. Холистически. smile.gif

Ас: У вас есть  идея по поводу  генетического кода  .. мол не так все кодируется как в классической модели..

ПГ: Не так говорю. По син кодонам все в соответствии  с  Моделью. А у не син кодонов (сиомах... Прочитайте, наконец 2-ю статью, что дал в Русском варианте...) так вот у сиом кодонов  все сложнее, с учетом рибосомой  контектстов мРНК.

Ас: Код имеет волновую природу , там есть  интерферренции  , неоднозначности , и прочие  магические явления  как в Квантовой механике  с  ее  непостижимыми элементарными частицами.

ПГ: Неверно. Код по линии сиом имеет контектно-вероятностную природу. Включается рибосомно-мРНКовый "интеллект текста". Это нанобиокомпьютерная система, работающая по текстам гены-мРНК. Квантовая часть в геноме - это другой, более высокий, уровень ген. кодирования, отвественный за биоморфогенез и базирующийся на квантовой нелокальности генов и ДНК-голографии. Долгий разговор. Опубликовано.


Ас: Но там  есть таки отмазка  что при всей непостижимости  электрона  мы таки пользуемся электричеством  и  есть  формулы  которые описывают поведение его  и на этих формулах базируются технологии  и практические применения электрона.

ПГ: у нас тоже есть "отмазка" - мы используем поляризацию (спинирование) лазерных фотонов как систему записи генетической информации на спиновых состояниях фотонов, сканирующих биосистему или часть ее. 

Ас: Вот я предложил вам показать  как можно увидеть  вашу правоту экпериментальным образом.
нарисуйте  два гена  согласно вашей теории    и давайте их экспрессируем  в бактериях  и  увидим  что ваши предсказания  работают,  а классическая модель не работает. 
Только не надо про селеноцистеин, там есть совершенно обычный механизм, никакой эзотерики.

ПГ: Ну что это за механизм? Изложите, пожалуйста.
Насчет экспрессии генов - давно хотел...  Делаем так. Найдите два длинных гена на большие белкИ. Получите их мРНК, секвенируйте их с точной разбивкой на кодоны. Секвенируйте белок. Если сиквенсы того и другого есть в базах данных, прекрасно. Проверьте коллинеарность кодоны-аминокислоты согласно таблице Кода. Какую таблицу будете использовать, зависит от происхождения бека. Поэтому, понятно, надо использовать колиные белкИ, поскольку стандартная таблица кода колиная. 
Если обнаружатся нарушения коллинеарностей, я прав. Нет - вы. Вероятность обнаружения нарушений повышается в зависимости от длины текста мРНК.
Много подводных камней в виде возможных прыжков рибосомы по мРНК, и надо будет знать места старта и финиша прыжков. Надо будет учитывать возможные сдвиги рамок считывания мРНК. Ну и прочие приключения рибосом на мРНК.
Любой правильный полученный результат будет крутым.


Ас: Ну и не надо обращаться к ошибкам трансляции, да рибосома может ошибаться  и  вставлять  другие аминокислоты , так же как и синтез  ДНК  и  РНК  тоже происходит с ошибками.  Но это все редкости , а нам нужна  100%  воспроизводимая ситуация , которую можно в  любой лаборатории проверить  и воспроизвести.

ПГ: в том-то и трудность учесть ошибки. А как? Боюсь, эксперимент  в этом плане очень не прост. И вообще, коллинеарности проверяли очень мало и на коротких белкАх.

Проще воспользоваться уже имеющимися публикациями на работы Лолли и Прюита и работу группы Туранова. Ссылки на них давал. Они же и в двух моих статьях (см. выше). где, по сути продемонстрировано то, что пытаюсь доказать. Только Лолли и Прюит не поняли этого, а я им писал. Группа Туранова тоже не объяснила суть неоднозначного кодирования ОДНИМ кодоном ДВУХ РАЗНЫХ аминокислот. Поэтому и жду Вашего объяснения.


Давайте отделим эзотерику от науки... Это разные платформы мировоззренческие.




banned sceptique-NMRguy 18.06.2019 17:39
(Asterix @ 18.06.2019 16:22)
Ссылка на исходное сообщение  вот  в качестве метафористического  текста ... ,   перерыв в беседе.   на обед.

КОКА-КОЛА С НЕБА
( пути к богатству исповедимы)
На Startup Village в Сколково,


http://bible.optina.ru/new:2pet:03:start ( http://bible.optina.ru/new:2pet:03:start )

Прежде всего знайте, что в последние дни явятся наглые ругатели, поступающие по собственным своим похотям и говорящие: "Где обетование пришествия Его? Ибо с тех пор, как стали умирать отцы, от начала творения, все остается так же." Думающие так не знают, что вначале словом Божиим небеса и земля составлены из воды и водою: потому тогдашний мир погиб, быв потоплен водою.

А нынешние небеса и земля, содержимые тем же Словом, сберегаются огню на день суда и погибели нечестивых человеков. Одно то не должно быть сокрыто от вас, возлюбленные, что у Господа один день, как тысяча лет, и тысяча лет, как один день. Не медлит Господь исполнением обетования, как некоторые почитают то медлением; но долготерпит нас, не желая, чтобы кто погиб, но чтобы все пришли к покаянию. Придет же день Господень, как тать ночью, и тогда небеса с шумом прейдут, стихии же, разгоревшись, разрушатся, земля и все дела на ней сгорят.

Если так все это разрушится, то какими должно быть в святой жизни и благочестии вам, ожидающим и желающим пришествия дня Божия, в который воспламененные небеса разрушатся и разгоревшиеся стихии растают? Впрочем мы, по обетованию Его, ожидаем нового неба и новой земли, на которых обитает правда.

Итак, возлюбленные, ожидая сего, потщитесь явиться пред Ним неоскверненными и непорочными в мире; и долготерпение Господа нашего почитайте спасением, как и возлюбленный брат наш Павел, по данной ему премудрости, написал вам, как он говорит об этом и во всех посланиях, в которых есть нечто неудобовразумительное, что невежды и неутвержденные, к собственной своей погибели, превращают, как и прочие Писания.

Итак вы, возлюбленные, будучи предварены о сем, берегитесь, чтобы вам не увлечься заблуждением беззаконников и не отпасть от своего утверждения, но возрастайте в благодати и познании Господа нашего и Спасителя Иисуса Христа. Ему слава и ныне и в день вечный. Аминь.




Рекрут 18.06.2019 22:36
Астерикс, а может, с моих позиций рассмотрим Ваши недоумения:

Ас: "Нет , тут дело в иронии программиста этого приложения я так думаю... я похоже первый эту глубокую шутку нашел.
Остальные наверное только удивлялись .. что ж такое-то , оптимизируем оптимизируем, а результат одинаковый как и не было никакой оптимизации... а вот он Лейцин какой , закладочка оказалась в коде , шутка программиста, .. теперь все понятно."

ПГ: Свои первичные соображения уже в той теме высказал. Теперь можно попытаться развить идею, что кодоны лейцина находятся в двоякой функции, поскольку принадлежат с одной стороны четверке семейства CT, то есть син кодонов. С другой, четверке семейства TT, то есть гибридных по Лагерквисту синонимо-омонимических кодонов (сиом кодоны). http://wavegenetics.org/wp-content/uploads...-OJGEN-Russ.pdf ( http://wavegenetics.org/wp-content/uploads/2019/01/2-ya-v-OJGEN-Russ.pdf ) В этом сиом варианте кодирование НЕ ТАБЛИЧНОЕ. И в синтезируемый белок может включаться вместо лейцина фенилаланин, если ориентироваться на стандартную таблицу кода E.coli. Вы какую таблицу использовали? Арабидопсисовую или колиную? И есть-ли Арабидопсисовая таблица кода как диалект колиной? Не видел. Вроде, нет такой.

Вот вам платформа для проверки моей идеи о двукратной синонимо-омонимической вырожденности белкового кода. И для трактовки странных замен лейцина в Вашей работе.
Это, наверно, проще, чем секвенировать мРНК генов и их белков, а потом искать соблюдения или не соблюдения канонических коллинеарностей.



Asterix 19.06.2019 01:09
Код по линии сиом имеет контектно-вероятностную природу. Включается рибосомно-мРНКовый "интеллект текста". Это нанобиокомпьютерная система, работающая по текстам гены-мРНК.
///////

Ну давайте же эксперимент напишите .. с четкой конфигурацией.. и с выводами по результатам ..

наука не оперирует фактором Бога и потусторонних сил. Это граница между эзотерикой и наукой ... В науке нет Бога, это самодостаточная система ... а в эзотерике он главная действующая сила которая управляет миром и овладение ритуалами по вызову нужных духов - это центральная часть эзотерического обучения.

В вашем случае вы вызываете Духа Генетики посредством сложного лазерного ритуала с элементами шаманского транса и просите его сделать то что вы хотите получить , и он иногда вам помогает , но полной власти над этим духом у вас нет.

В науке данная эзотерическая практика не используется.

И опубликовать статью про материализацию ДНК в пробирке посредством эзотерических ритуалов будет весьма непросто. Ну разве что на 1 апреля возьмут. Ученые ведь тоже шутят иногда.



Asterix 19.06.2019 01:59
Вот вам Петрович балзам на душу про неопределенность генома ... Но правда апрелький номер конечно ... но выглядит очень круто. И не подкопаться. Про осьминогов и их замечательную систему редактирования РНК.

https://news.uchicago.edu/story/smart-cepha...-ability-evolve ( https://news.uchicago.edu/story/smart-cephalopods-adapt-editing-genetic-code-sacrifice-ability-evolve )



Рекрут 19.06.2019 08:30
(Asterix @ 19.06.2019 02:59)
Ссылка на исходное сообщение  Вот вам Петрович балзам на душу про неопределенность генома ...  Но правда  апрелький номер конечно ... но  выглядит очень круто.  И не подкопаться.  Про осьминогов и их замечательную систему  редактирования  РНК.

https://news.uchicago.edu/story/smart-cepha...-ability-evolve ( https://news.uchicago.edu/story/smart-cephalopods-adapt-editing-genetic-code-sacrifice-ability-evolve )

Прекрасно. Так это все-таки хохма или всерьёз?
В любом случае возникает совершенно очевидная мысль: геном осьминогов соображает, иначе редактирования не будет, даже если отдать сию редколлегию на откуп физхимии, как хотят правоверные ген-материалисты. А геном наших нейронов? Мы им думаем. Больше нечем. Или за нас думает матушка-Вселенная. То есть снова к Богу идем... Но Спиноза тысячу раз прав - Природа = Бог. Если так, тогда эзотерика будет выглядеть неприлично. tongue.gif
Ваш термин "неопределенность генома" (камешек в огород его сиомического атрибута smile.gif) не проходит. Не снятая неопределенность генома есть гибель биосистем. НЕ надо. Снятие идет при помощи вероятностно-контекстных соображательных Актов в геноме.



Рекрут 19.06.2019 08:52
(Asterix @ 19.06.2019 02:09)
Ссылка на исходное сообщение  Код по линии сиом имеет контектно-вероятностную природу. Включается рибосомно-мРНКовый "интеллект текста". Это нанобиокомпьютерная система, работающая по текстам гены-мРНК.
///////

Ас: Ну давайте же эксперимент   напишите ..  с четкой конфигурацией.. и  с выводами по результатам ..

ПГ: Уже написал. См. выше.

АС: наука не оперирует фактором Бога   и потусторонних сил.  Это граница между эзотерикой и наукой ... В науке  нет Бога, это  самодостаточная система  ... а в эзотерике он главная действующая сила которая управляет миром  и овладение ритуалами  по вызову нужных духов - это центральная часть эзотерического  обучения.

ПГ: Что Вы все время трясетесь с Богом. Поклонитесь лучше Спинозе и Гегелю. В их системе знаний Бог излишен. Распределен в Природе и Абсолютной идее. 

Ас: В вашем случае  вы вызываете  Духа Генетики  посредством  сложного лазерного ритуала  с элементами  шаманского транса    и просите его  сделать  то что вы хотите получить , и он иногда вам помогает , но полной власти  над этим духом у вас нет.

ПГ: Не стоит использовать влияния на Вас экзогенной иньецированной ДНК на понимание физики работы нашего лазера ЛГН-303. Никаких "сложных лазерных ритуалов" ни я, ни сотрудники не используем. Правда, тех кто пытается по пьянке получить лазерные мШЭИ спектры, от такой работы отстраняю. 

Ас: В науке данная  эзотерическая практика не используется.

ПГ: Точно. "И я и я такого же мненИЯ" smile.gif

Ас: И опубликовать  статью про материализацию  ДНК в пробирке  посредством  эзотерических ритуалов    будет весьма непросто.  Ну разве что на 1 апреля возьмут. Ученые  ведь тоже шутят  иногда.

ПГ: Так мы уже опубликовали, и без всякой эзотерики:
DNA Decipher Journal | March 2016 | Volume 6| Issue 1 | pp. 01-11
Gariaev, P. P., Vladychenskaya, I. P. & Leonova-Gariaeva, E. A., PCR Amplification of Phantom DNA Recorded as Potential Quantum Equivalent of Material DNA
https://dnadecipher.com/index.php/ddj/article/view/98 ( https://dnadecipher.com/index.php/ddj/article/view/98 )




Рекрут 19.06.2019 11:28
(Asterix @ 19.06.2019 02:59)
Ссылка на исходное сообщение Вот вам Петрович балзам на душу про неопределенность генома ... Но правда апрелький номер конечно ... но выглядит очень круто. И не подкопаться. Про осьминогов и их замечательную систему редактирования РНК.

https://news.uchicago.edu/story/smart-cepha...-ability-evolve ( https://news.uchicago.edu/story/smart-cepha...-ability-evolve )

ПГ: Прекрасно. Так это все-таки хохма или всерьёз?

В любом случае возникает совершенно очевидная мысль: геном осьминогов соображает, иначе редактирования не будет, даже если отдать сию редколлегию на откуп физхимии, как хотят правоверные ген-материалисты. А геном наших нейронов? Мы им думаем. Больше нечем. Или за нас думает матушка-Вселенная. То есть снова к Богу идем... Но Спиноза тысячу раз прав - Природа = Бог. Если так, тогда эзотерика будет выглядеть неприлично. tongue.gif
Ваш термин "неопределенность генома" (камешек в огород его сиомического атрибута smile.gif) не проходит. Не снятая неопределенность генома есть гибель биосистем. НЕ надо. Снятие идет при помощи вероятностно-контекстных соображательных Актов в геноме.



Asterix 19.06.2019 12:17
Петровичь, вы пользуетесь каким-то странным самодельным языком ... в эзотерике есть свои устоявшиеся способы описания структуры мира и его волновой природы.

Не надо использовать научный язык , он разрушает эзотерический подход поскольку подразумевает отсутсвие Бога в Уравнении Вселенной.

Ваш концепт Волновая Генетика восходит к Библии, ( если не копать еще глубже в даль веков) В Начале было Слово , то есть Знание . Из точки возникла сфера которую Дух сдвинул на волосок , из этого изначального движения возник матрикс нашего мира , Время-Пространство ...

Ну и так далее ... это обычный курс сакральной геометрии в комплексе эзотерики. Волновая природас всего нашего мира там возникает совершенно естесвенным и логическим образом и является неоспоримой истиной. Ее не надо доказывать. Она есть.

И Волновая генетика - это частное приложениие общей Волновой теории Мира.

Вам не нужны научные эсперименты , они имеют смысл только в научной системе координат. Не надо маскировать эзотерику под науку пользуясь научной тер,имологией .. это никому не надо. Это вызывает раздражение и непонимание.



Рекрут 19.06.2019 15:59
(Asterix @ 19.06.2019 13:17)
Ссылка на исходное сообщение  Петровичь, вы пользуетесь каким-то странным  самодельным языком  ... в эзотерике есть  свои устоявшиеся способы описания структуры мира  и  его волновой природы.

ПГ: я не эзотерик. Провести четкую границу между эзотерикой и т.н. официальной наукой затруднительно, если вообще возможно.

Ас: Не надо использовать  научный язык , он разрушает  эзотерический подход поскольку подразумевает  отсутствие Бога  в Уравнении Вселенной.

ПГ: Пантеизм Спинозы, которого придерживаюсь, не отрицает Бога, но равномерно распределяет его в Природе, придавая ей Божественность. Уравнения Вселенной Нет. 

Ас: Ваш концепт  Волновая Генетика  восходит к Библии, ( если не копать  еще глубже  в даль веков) В Начале было Слово , то есть  Знание . 

ПГ: Перевод неточный.  Вначале была Мысль, которая материализовалась в Слово, а оно в Природу, включая Человека. Идеальное (от Идея) всегда опережает Материальное.

Ас. Из  точки возникла сфера  которую  Дух  сдвинул на волосок , из этого  изначального движения возник матрикс  нашего мира  , Время-Пространство ...

ПГ: Из бесконечно малого  (условно, точки) возникло вращательное перводвижение - элементарная частица-волна, допустим, Бозон Хигса, а с ним и Пространство-Время.

Ас: Ну и так далее ... это  обычный курс   сакральной геометрии  в комплексе эзотерики. Волновая природа  всего нашего мира  там возникает  совершенно естественным   и логическим образом и  является неоспоримой истиной. Ее не надо доказывать. Она есть.

ПГ: Пантеизм говорит "возникать" ничему не надо. Волновое потенциально УЖЕ присутствует в перводвижении, вращательном = волновом.

Ас: И Волновая генетика - это частное приложениие  общей Волновой теории  Мира.

ПГ: Это неоспоримо.

Ас: Вам не нужны научные эксперименты , они имеют  смысл  только  в научной системе координат. Не надо  маскировать  эзотерику под науку  пользуясь научной терминологией  .. это никому не надо.  Это  вызывает раздражение и непонимание.

ПГ: Раздражение от использования,к примеру, слова КОДОНЫ? Но они реальность, не заменяемая эзотерикой. Это как раз та область, где происходит взаимная диффузия, перетекание методов науки и методов (рассуждений) эзотерики.  Ин-Янь. Ничего страшного в этом нет. Чего боитесь? Самих себя? Раздражаться контр продуктивно.
Надо работать. И не только головой, порождая идеи, но и воплощать их в плоть  руками. "Сами Боги" ... помните  Айзека Азимова?





Рекрут 19.06.2019 17:45
А вы так и ушли от моих вопросов:

1. Где ошибка, заблуждение в моих, чисто теоретических, доказательствах недостроенности модели Кода Белков Ниренберга-Крика, недостроенности, связанной с двукратной вырожденностью кода, которую они не заметили? Или проигнорировали?

2. Не дали объяснение необъясненному в работе Туранова и др., где обнаружено двойное кодирование одним кодоном UGA двух РАЗНЫХ аминокислот, что противоречит канонам модели Кода.

3. Дал описание эксперимента, который должен доказать или опровергнуть канон ген. Кода о строгой коллинеарности кодоны---аминокислоты. Будете ставить его?

4. Или теоретически разберетесь в экспериментально показанной вами странности в кодировании лейцина в отношении его кодона?

Пока ни одного ответа...



Рекрут 19.06.2019 17:53
Кстати, можете поучаствовать https://atelje12.si ( https://atelje12.si )



Asterix 19.06.2019 21:04
Где ошибка, заблуждение в моих, чисто теоретических, доказательствах ..
/////
Да нет никаких ошибок в эзотерических теориях , это все одно единое Знание на одной платформе . ошибки бывают только в научной теории которая базируется на научном методе ... .. В этом разница между эзоитерикой и наукой.

Ни одна эзотерическая теория еще никогда не была опровергнута .. ибо это просто невозможно сделать.

Если вы хотите доказать что ваш теория не эзотерическая, а научная .. вам надо расписать эксперименты для этой цели... научные эксперименты, без заклинаний и вызывания духов при помощи лазерного света.



banned sceptique-NMRguy 19.06.2019 21:35
Гаряй Гаряич считает доказанным сразу всё, что несёт изначально. Он просто не сомневается ни в чём и всё - и доказательства не нужны. Можно выходить и радовать мамаш детей-инвалидов, и пить водку, кидая вокруг всех направо и налево.

А, Гаряй Гаряич?

Для того, что маяться изучением всякой таинственной хрени и ересей нужно воображение. А тут оно как раз и отсутствует. Поскольку если бы было на месте - в жизни Гаряй Гаряича было множество более полезных и радостных событий. А так его именем уже детей смешат в универах, типа как Чарли Чаплин. Скажешь - уже смешно. lol.gif



Asterix 19.06.2019 21:54
Вот Вызвал я вчера Духа Генетики и дал ему задание ... бля, ну не знаю, все против правил, все против меня, а мне лень.., ты мне забацай там ... чтоб все хорошо было.

Ну он и забацал ... как всегда впрочем. Вместо двух генов сделал мне 3 .. у них так положено наверное , Бог и Сатана одну Троицу любят. Но ипостаси разные.

Вот бля , наперсточник ... но я таки разобрал где лишний шарик , под каким стаканом.

Теперь вот демона безлигазного лигирования буду вызывать.. Чего уж мелочиться... Пусть поработает, но что он с меня попросит в обмен ... - это загадка.
Душу уж точно не попросит .. это не его сфера, душа моя в Другом Банке заложена. ... но напакостить мелкой просьбой вполне может. И я по правилам игры не смогу ему отказать в этом пустячке.

https://www.facebook.com/photo.php?fbid=326...SuH7Iy_eHx9y8vv ( https://www.facebook.com/photo.php?fbid=3260697847277458&set=pcb.3260701797277063&type=3&__tn__=HH-R&eid=ARAddl6_VhNxzwcpGwOfBU8KRbukcxX7BCQL0gwcFa9yS59QkQWAhN0RRoggOY-5kSuH7Iy_eHx9y8vv )



Рекрут 19.06.2019 21:56
(Asterix @ 19.06.2019 22:04)
Ссылка на исходное сообщение  Где ошибка, заблуждение в моих, чисто теоретических, доказательствах ..
/////
Ас: Да нет никаких ошибок в эзотерических теориях ,  это  все одно единое  Знание  на одной платформе  .  ошибки бывают только в научной теории  которая базируется на научном  методе ... ..  В  этом разница между эзоитерикой и наукой.

ПГ: В моих теоретических построениях нет эзотерики, равно как и в экспериментах. Зачем вы приписываете это мне? Это чисто научные данные. И это повторяю уже много раз. Насчет пирамиды, так это походя сказал. Если тут нечто эзотерическое, ну и что? Это никак не влияет на то, что реально делаю.

Ас: Ни одна эзотерическая теория  еще никогда не была опровергнута .. ибо  это просто невозможно  сделать.

ПГ: похоже, вам нечем ответить. А кивки в сторону моей якобы эзотерики похожи на отмазку.

Ас: Если вы хотите  доказать  что ваш теория не эзотерическая,  а научная .. вам надо  расписать  эксперименты  для этой цели... научные эксперименты, без  заклинаний и вызывания духов при помощи лазерного света.

ПГ: Еще раз. Никаких духов и заклинаний у нас нет. Глупости говорите. Наши эксперименты расписаны, доказаны и поэтому опубликованы в рейтинговых, отнюдь не эзотерических, журналах. Вы что, дурака валяете? Так прямо и скажите - испугался, не хочу с Вами дискутировать. Вы же предлагали поставить эксперименты. Я и предложил - либо проверить коллинеарности на больших белкАх, либо с кодированием лейцина разобраться.
Ладно, не хотите вместе подумать, поработать - не надо. 




Рекрут 19.06.2019 22:03
(Asterix @ 19.06.2019 22:54)
Ссылка на исходное сообщение  Вот Вызвал я вчера Духа Генетики и дал ему задание ... бля, ну не знаю, все против правил, все против меня, а мне лень.., ты мне забацай там ... чтоб все хорошо было.

Ну он и забацал ... как всегда впрочем. Вместо двух генов сделал мне 3 .. у них так положено наверное , Бог и Сатана одну Троицу любят. Но ипостаси разные.

Вот бля , наперсточник ... но я таки разобрал где лишний шарик , под каким стаканом.

Теперь вот демона безлигазного лигирования буду вызывать.. Чего уж мелочиться... Пусть поработает, но что он с меня попросит в обмен ... - это загадка.
Душу уж точно не попросит .. это не его сфера, душа моя в Другом Банке заложена. ... но напакостить мелкой просьбой вполне может. И я по правилам игры не смогу ему отказать в этом пустячке.

https://scontent-bru2-1.xx.fbcdn.net/v/t1.0...398&oe=5DBE9F3C ( https://scontent-bru2-1.xx.fbcdn.net/v/t1.0-9/65010887_3260697853944124_1147329040575627264_n.jpg?_nc_cat=111& _nc_eui2=AeFTwyT3Cw7QwCm9dkCpeEwzd2rvlXayTGs_njGRyQZva9eCWFxX4IjlbuSsAZHvbAKdJBn8cwxpcBvscbIXXopi24t
DoJMkq7iHM9hyweVt-A&_nc_oc=AQlq6_AFMwfL4-xMMeoi8-ocr3lF_vSHJvNwph5PXAGGwuolRP_cS-uTr5FWMhJUWyk&_nc_ht=scontent-bru2-1.xx&oh=b00a0fa1f3c953753364972e5dce3398&oe=5DBE9F3C
)


Ээээ, да вы батенька обкурились, видать, чужеродной ДНК. Или дурилочку делаете.



Asterix 19.06.2019 22:04
Ну напишите же четкий научный эксперимент научным языком... давайте вместе его отредактируем ... Я помогу , мне это несложно.

Без Разума Вселенной пожалуйста ... он в науке - мнимая величина .


Нужны самые тупые эксперименты, доступные даже школьникам .



Asterix 19.06.2019 22:09
И зачем отрицать очевидное? Это Вас никак не красит ... прям как тот самый апостол Петр .. отказался от Исуса как и было предсказано...

Не отказывайтесь от Бога ... гните Его линию. Он Спаситель.

ПГ: В моих теоретических построениях нет эзотерики, равно как и в экспериментах. Зачем вы приписываете это мне? Это чисто научные данные. И это повторяю уже много раз. Насчет пирамиды, так это походя сказал. Если тут нечто эзотерическое, ну и что? Это никак не влияет на то, что реально делаю.



Рекрут 19.06.2019 22:49
(Asterix @ 19.06.2019 23:04)
Ссылка на исходное сообщение  Ну напишите же  четкий научный эксперимент  научным языком... давайте вместе его отредактируем ...  Я помогу , мне это несложно.

Без  Разума Вселенной пожалуйста ... он в  науке  -  мнимая величина .
Нужны самые тупые эксперименты,  доступные даже школьникам .

Я его уже расписал здесь. Не найду. Стерли. Ну я кратко, еще раз.

Берете длинный ген E.coli, транслируете его в мРНК, синтезируете белок. Проверяете коллинеарность кодонов иРНК и аминокислот полученного белка.
Предсказываю, и это надо проверить, что в случае син кодонов включаемые аминокислоты будут по Стандартной Таблице кода (если не будет СЛУЧАЙНЫХ ошибок трансляции мРНК и СЛУЧАЙНЫХ ошибок при трансляции белка).

В случае не син кодонов (сиом кодонов) могут быть не соответствия включения аминокислот в растущий белок. Не соответствия стандартной Таблице кода.

Чем длиннее белок, тем выше вероятность включения "неправильных" аминокислот, либо неправильная остановка синтеза белка.

Эксперимент тупее некуда. Странно, что такие не ставили с ТАКОЙ целью.

Помогите, как обещали, если где-то в плане постановки эксперимента ошибся.



Asterix 19.06.2019 23:03
Ну нарисуйте же 2 гена которые кодируют один и тот же белок ... , пусть будут короткие по 300 нуклеотидов то есть по 100 аминокислот с [ HiS6] тагом на конце , так легче работать.

И сделайте во второй копии гена замены кодонов согласно вашей теории.. И скажите что вы ожидаете увидеть... какие именно эффекты.

Куда же еще проще-то? Надо конкретно все расписать .. без блужданий , может то, а может это... а может вообще все не так ...



Рекрут 20.06.2019 00:49
(Asterix @ 20.06.2019 00:03)
Ссылка на исходное сообщение  Ну нарисуйте же  2 гена  которые кодируют  один и тот же белок  ... , пусть будут  короткие  по  300  нуклеотидов

ПГ: короткие - это понижает вероятность перекодировок сиом, поскольку контекст мРНК будет тупой.

  то есть по  100  аминокислот  с [ HiS6] тагом на конце , так легче работать.

Ас: И  сделайте  во второй копии  гена замены кодонов согласно вашей теории..  И скажите что вы ожидаете увидеть...  какие именно эффекты.

ПГ: такой пассаж говорит, что Вы не поняли главного. Замены делаем не мы, а соображающая и читающая контекст мРНК рибосома. Если она, исходя из смысла мРНК и встретив сиом кодон, "решит", что надо делегировать 3'-нуклеотиду сиома значение определенной буквы, то это МОЖЕТ изменить смысл сиома. Говорю МОЖЕТ потому, что смыслы мРНК - вещь тонкая.  Это чтение рибосомой мРНК МОЖЕТ (вероятность) привести к замене аминокислоты по сравнению с Табличной. Это будет нарушением коллинеарности, что и надо для доказательства двукратной вырожденности Кода.  Все зависит от смысла мРНК, который понимает пока только рибосома. Семантический ареал мРНК плавающий. Здесь работает Налимовско-Бейесовская вероятностная модель-уравнение для человеческих текстов, фильтрующее определенные смыслы текстов. (В.В.Налимов. Вероятностная модель языка. 1979 г.)

Ас: Куда же еще проще-то? Надо  конкретно все расписать .. без    блужданий  ,  может то,  а может это...  а может вообще все не так ...

ПГ: Блуждания-то у Вас. Перечитайте 2-ю статью. Чтобы не блуждать и не путаться среди 3-х сосен, то бишь 3-х букв триплетов. Все не так просто. "Все гораздо интересней, чем на самом деле".




Рекрут 20.06.2019 01:04
Так что не надо 2 гена. О один выберите сами у E.coli. Для простоты. Но можно и два, но разных и длинных. В сложных (длинных) белковых "фразах" более высокая вероятность нескольких смыслов, переписанных (транслированных) с мРНК транскриптов. И больше потенциально готовых к перекодировкам сиом кодонов. На коротких вряд-ли получишь это. Тем более на простых генах с повторяющимися последовательностями типа поли-ГЦАТ, т.е. бессмысленными.



Asterix 20.06.2019 01:18
Ну хорошо давайте возьмем ГФП , зеленый флюоресцентный белок..

там примерно 1000 нуклеотидов, и его легко видеть , просто посветил на колонии бактерий светодиодным фонариком с 450нм светом и видишь флюоресценцию , если она есть, то есть белок функционален.

И давайте заменим ему эти важные аминокислоты необходимые для флюоресценции на сиом -кодоны , которые в классической модели кода должны кодировать другие аминокислоты и белок светиться перестанет, а по вашей модели таки будет светиться поскольку рибосома прочтет некие инструкции в контексте гена.

Вам дать сиквенс еГФП? с которым я работаю?



Рекрут 20.06.2019 10:29
(Asterix @ 20.06.2019 02:18)
Ссылка на исходное сообщение  Ну хорошо  давайте возьмем  ГФП , зеленый флюоресцентный белок..

там примерно  1000  нуклеотидов,  и его легко  видеть  , просто посветил на колонии бактерий  светодиодным фонариком  с 450нм светом и видишь  флюоресценцию  , если она есть,  то  есть белок функционален.

И давайте заменим ему эти  важные аминокислоты  необходимые для флюоресценции    на  сиом -кодоны , которые в классической модели кода  должны кодировать другие аминокислоты  и  белок светиться перестанет,  а по вашей модели таки будет светиться поскольку рибосома прочтет  некие инструкции в контексте  гена.

ПГ: Это уход несколько в сторону. Не аминокислоты надо заменять а сиом кодоны. Тогда рибосома, ориентируясь на контекст мРНК должна вернуть прежние сиомы и свечение останется. Тогда надо будет констатировать возврат старых сиом. Это осложняет задачу.
Но можно проще. Если есть сиквенс еГФП и сиквенс его мРНК, то надо просто проверить их кодон-аминокислотную коллинеарность. Если она на отдельных парах сиом-аминокислота  нарушается по сравнению с канон Таблицей, то это уже результат.

Вам дать  сиквенс  еГФП?  с которым я работаю?

ПГ: Не надо, я соображаю пользуясь Русским языком, а у мРНК и Белков свои языки, нам пока неведомые. А логику соображений рибосомы мы тоже пока не знаем. Может, она иная по сравнению с нашей. smile.gif




Asterix 20.06.2019 14:22
Ну вот вам ОРФ зеленого белка... На сайте есть все инструменты для работы с ДНК и для трансляции ее в аминокислотный код. В Википедии можно посмотреть какие там самые главные аминокислоты и вот сделать новую версию гена , которая согласно классической модели кода не должна давать функциональный белок , а согласно вашей модели что-то произойдет и рибосома заменит кодоны на правильные и белок таки будет светиться.

Это и есть научный метод , если есть что-то неизвестное нам , tо делаем гипотезу , проводим эксперимент и проверяем соответсвие гипотезы результату.
По итогу работы делаем выводы.. И опять и опять ... один и тот же цикл до ычи знания.

В эзотерике знание получают сразу и в цельном виде путем откровения , подключившись к каналу связи с Высшим Разумом Вселенной. Эти откровения не нуждаются в экспериментальном методе.

[ATGGTGAGCAAGGGCGAGGAGCTGT
TCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCA
GCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCT
GCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCG
TGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCA
TGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGA
CCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCA
TCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCC
ACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCC
GCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCA
TCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGA
GCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCG
GGATCACTCTCGGCATGGACGAGCTGTACAAGTAA]



Рекрут 20.06.2019 16:32
(Asterix @ 20.06.2019 15:22)
Ссылка на исходное сообщение  Ну вот вам ОРФ  зеленого белка...

Ас: На сайте есть все инструменты  для работы с  ДНК  и  для трансляции  ее в аминокислотный код.   

ПГ: Дайте, пож-ста, ссылку на сайт.

Ас: В Википедии можно посмотреть какие там самые главные аминокислоты  и вот  сделать новую версию гена , которая  согласно классической модели кода не должна давать  функциональный белок  , а согласно вашей модели что-то произойдет  и  рибосома заменит кодоны  на правильные и белок таки будет  светиться.

ПГ: Кстати, если зеленый из Эквореи, то есть ли ее диалект Таблицы ген. кода? И будет-ли "зеленая" мРНК читаться также как в E.coli? И тут, как видим, непросто. Проблемы ветвятся.

Ас: Это  и есть научный метод , если  есть что-то неизвестное нам , tо делаем гипотезу , проводим эксперимент  и проверяем соответсвие гипотезы  результату.
По итогу  работы  делаем выводы..  И опять и опять ...  один и тот же цикл  до ычи  знания.

ПГ: Естественно.


Ас: В эзотерике  знание получают сразу  и в цельном  виде путем откровения  , подключившись  к каналу связи  с Высшим Разумом Вселенной. Эти откровения не нуждаются в экспериментальном методе. 

ПГ: Так откровения не всегда дают полные ответы, скорее наводят на мысль, заставляют думать. У меня были такие неполные откровения. Например, с тем же белковым Кодом. Где-то на 4-м - 5-м курсе. Все упорно и без мысли пялятся на канон таблицу Кода, верят в ее целомудрие, а у меня что-то засветилось в сознании - не то, не так... И потом, не сразу : если 3'-нуклеотид в кодонах вобулирует, то код не точен для не синонимов... И пошло и поехало. До двукратной (двумерной) вырожденности кода. Но уже без подсказок свыше. Тут сам потел. И еще много таких вспышек было, инициирующих, связанных с фантомами ДНК, листовыми фантомами и т.д.
Так что делать будем? Как видим, все усложняется...

[ATGGTGAGCAAGGGCGAGGAGCTGT
TCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCA
GCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCT
GCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCG
TGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCA
TGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGA
CCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCA
TCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCC
ACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCC
GCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCA
TCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGA
GCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCG
GGATCACTCTCGGCATGGACGAGCTGTACAAGTAA]




Asterix 20.06.2019 21:11
зайдите в раздел расчеты на молбиоле ... там все есть

Меня вот сегодня выпытывали как сделать светящююся плесень , фузариус , чтоб видна была колонизация растений его мицелием.

Ну запросто же все делается , и никакой эзотерики , чистая научная техника. Просто надо все знать.

И иметь уважение в среде научных демонов ...

Вот сегодня опять вызвал демона лигирования и сказал ему прямо что если завтра я не увижу клонов мне нужных ... то ему не поздоровится ..

И все будет , у них там мало людей вроде меня , понимающих их мир.. и умеющих с ними обращаться. Демону этому ничэго не стоит сделать мне лигирование так как мне надо. Даже без лигазы .. вообще в чистой воде.



vb 21.06.2019 04:50
(Рекрут @ 19.06.2019 06:30)
Ссылка на исходное сообщение  Прекрасно. Так это все-таки хохма или всерьёз?
В любом случае возникает совершенно очевидная мысль: геном осьминогов соображает, иначе редактирования не будет, даже если отдать сию редколлегию на откуп физхимии, как хотят правоверные ген-материалисты. А геном наших нейронов? Мы им думаем. Больше нечем. Или за нас думает матушка-Вселенная. То есть снова к Богу идем... Но Спиноза тысячу раз прав - Природа = Бог. Если так, тогда эзотерика будет выглядеть неприлично. tongue.gif 
Ваш термин "неопределенность генома" (камешек в огород его сиомического атрибута smile.gif) не проходит. Не снятая неопределенность генома есть гибель биосистем. НЕ надо. Снятие идет при помощи вероятностно-контекстных соображательных Актов в геноме.

И спиритуальных завихрений континума



Asterix 21.06.2019 05:17
vb, .....
если вы видите подоплеку эзотерическую то все становится на свои места и Петрович совешенно нормальный эзотерик... просто он не знает об этом ... и я вот здесь пытаюс' емy это обьяснить.

Вот ведь весь Физтех не смог, бедные дети там учатся ... , а я могу и делаю это совершенно приличным образом, без мата и истерики ... просто обьясняю человеку суть его идей. Мне приходится много раз повторять одно и тоже ... но я уже привык со своими студентами по программе Эразмус к таким проблемам.

Это несложно ... главное чтоб огонь в глазах горел и живой интерес к науке был бы. Остальное я сделаю.



Рекрут 21.06.2019 09:52
Ас: И иметь уважение в среде научных демонов ...

Вот сегодня опять вызвал демона лигирования и сказал ему прямо что если завтра я не увижу клонов мне нужных ... то ему не поздоровится ..

И все будет , у них там мало людей вроде меня , понимающих их мир.. и умеющих с ними обращаться. Демону этому ничэго не стоит сделать мне лигирование так как мне надо. Даже без лигазы .. вообще в чистой воде

ПГ: По сути, я делаю то же самое. Просто мысленно обращаюсь к матушке Вселенной разумной, где и демонам место. А уже Она своим подчиненным демонам дает указания по моей линии smile.gif
Если это эзотерика, то в таком виде она хороша. Но "на матушку надейся, а сам не плошай". И опять таки это не исключает наши ментальные манипуляции с ген. кодом, где "трансгенные инженеры" уже наломали дров. Нельзя же для работы с геномом-биокомпьютером пользоваться ломом.



Asterix 21.06.2019 13:17
Петровичь , я всю жизнь пользуюсь ломом при работе с генкодом ... и пока никаких жалоб у меня на мой инструмент и на генкод нет. Да и не было никогда .

Белки бывают плохо себя ведут , а гены они послушные . С ними что угодно можно делать. Не выходя за рамки стандартного кода.

На уровне генома да , чудеса иногда происходят ,и природа этих чудес нам непонятна ...

Но обьяснять это неким Вселенским Разумом я бы не стал, просто в этом нет никакой необходимости.



vb 21.06.2019 13:44
(Asterix @ 21.06.2019 03:17)
Ссылка на исходное сообщение  vb, .....
если вы видите  подоплеку эзотерическую то все становится на свои места и  Петрович совешенно нормальный  эзотерик... просто он не знает об этом ... и я вот  здесь  пытаюс' емy это обьяснить.

Вот ведь весь Физтех не смог,  бедные дети  там  учатся ... ,  а я могу и делаю это совершенно приличным образом, без мата и истерики ... просто  обьясняю человеку  суть его идей.  Мне приходится  много раз  повторять одно и тоже ... но я уже привык со своими студентами  по программе Эразмус  к таким проблемам.

Это несложно ... главное чтоб огонь в глазах горел  и живой интерес  к науке был бы.  Остальное я сделаю.

Да не вопрос.
Буду наблюдать, без особого оптимизма, впрочем.



Рекрут 21.06.2019 15:37
(Asterix @ 21.06.2019 14:17)
Ссылка на исходное сообщение  Петровичь ,  я всю жизнь пользуюсь ломом  при работе с генкодом ... и пока никаких жалоб у меня на  мой инструмент и на генкод нет.  Да и не было никогда .

Белки бывают плохо себя ведут ,  а гены  они послушные . С ними что угодно можно делать.  Не выходя за рамки  стандартного кода.

На уровне генома  да , чудеса иногда происходят ,и природа этих чудес  нам непонятна ...

Но обьяснять  это  неким Вселенским Разумом я бы не стал, просто в этом нет никакой необходимости.

Это потому, что не тронули главное - уровни кодирования на речевом и квантовом уровнях. Первый звоночек - непонятности для Вас - это непонятки с кодированием лейцина. Они на речевом уровне работы кода. Непонятности родом из четверки TT-семейства сиом кодонов. Именно в нем двойственность, не однозначность кодирования - то-ли фенилаланин кодировать, то-ли лейцин. Идет запрос рибосомы в контекст мРНК. Оттуда ответ: в соответствии со смыслом контекста мРНК, делегируем (виртуально) взамен теперешнего 3'-нуклеотида сиом кодона другой нуклеотид. Тогда триплет приобретет точное значение кодирования. И в белок включится ЛИБО фенилаланин, ЛИБО лейцин.
Это не чудеса, а известные законы лингвистики, которые едины для грамматик всех языков (Ноам Хомский). Вы бы "не стали объяснять это неким Вселенским Разумом", а вот В.В.Налимов стал (Спонтанность сознания. 1984 г.), сказав, что Вселенная СЕМАНТИЧНА.



Рекрут 22.06.2019 14:39
ПГ: Идет запрос рибосомы в контекст мРНК. Оттуда ответ: в соответствии со смыслом контекста мРНК, делегируем (виртуально) взамен теперешнего 3'-нуклеотида сиом кодона другой нуклеотид. Тогда триплет приобретет точное значение кодирования. И в белок включится ЛИБО фенилаланин, ЛИБО лейцин. Причем это ЛИБО не произвольно, не случайно, но определяется смыслом мРНК.

Кстати, Ас, определена таблица триплетного кода зеленого медузячьего белка? Если нет, тогда для проверки коллинеарности Ген----мРНК открытая рамка считывания гена не годится. Как тогда узнать какой из дублетов сиом кодирует лейцин, в случае один из 4-х нуклеотидов вирутально делегирован вместо имеющегося 3'-нуклеотида сиом кодона?
Что-то вы "приумолкли у окна", как Пушкинская няня...



Asterix 22.06.2019 15:51
Ну напишите же два варианта гена зеленого белка ... и предскажите что один должен работать по вашей теории но с точки зрения стандартной теории кодировки аминокислот в гене он работать не должен. Рассуждения о разумности рибосомы - это философия, для науки нужен научный подход , то есть эспериментально проверяемая гипотеза.

Тот вариант гена который я вам дал - это оптимизированнный вариант для експрессии в растениях. И мутант к тому же с аминокислотной заменой , у него лучше характеристики чем у нативного зеленого белка. меньше агрегирует и возбуждение сдвинуто почти на 100нм, тогда как эмиссия та же самая , зеленый свет.

Но это все не суть , ген рабочий и белок на нем рибосома синтезирует и он светится как и задумано.

Прекрасный обьект для ваших эспериментов по обнаружению разума у рибосомы. Вот поставьте рибосоме задачку которую она может решить только при наличии у нее разума. согласно вашей теории контекстного кодирования



Рекрут 22.06.2019 20:14
(Asterix @ 22.06.2019 16:51)
Ссылка на исходное сообщение  Ну напишите же два варианта гена   зеленого белка  ... и предскажите  что один должен работать  по вашей теории но с точки зрения стандартной теории кодировки  аминокислот  в гене  он работать не должен.  Рассуждения о разумности  рибосомы   - это философия, для науки  нужен  научный подход , то есть эспериментально проверяемая гипотеза.

ПГ: Основное уходит от Вас. Написать ДНК последовательность гена не сложно. Ну написал, допустим, и что? Не зная языка генов, логики принятия решения рибосомой как нано биокомпьютером, наверно, вкупе с логикой клетки, которая есть компьютер более высокого ранга... Что я могу предсказать? Пока ничего. Поэтому ограничимся пока скромными, но все таки знаниями, которые позволяют проверить мою гипотезу о некой разумности клеточно-рибосомных актов при биосинтезе белков. При этом я опираюсь на чисто экспериментальные результаты, которые однозначно говорят о квази разумном выборе системы клетка-рибосома-мРНК, выборе нужной аминокислоты (о стопах позже) из двух РАЗНЫХ, которые предоставлены шифровкой сиом кодонов, шифровкой, которая НЕ ОДНОЗНАЧНА (данные Ниренберга и Крика, УФН, 1994г. по сиом кодону UUU.  И данными группы Туранова, 2009г., Sciense по сиом кодону UGA). Итак, не тривиальная задачка, скорее всего, в предлагаемом Вами ключе, НЕ РАЗРЕШИМАЯ, отследить не нарушается-ли коллинеарность активной части зеленого гена-мРНК при биосинтезе зеленого белка.  При этом надо ориентироваться на таблицу ген. кода именно медузы - производителя зеленого белка, но не на стандартную Таблицу Кода E.coli. Есть таблица ген. кода этой медузы? Уже спрашивал. Допустим, есть. Тогда надо сопоставить Эти Табличные данные с разбивкой мРНК зеленого гена  на кодоны (предполагаем, что  в зеленой мРНК есть сиом кодоны). Допустим, все получилось по Таблице. Это для моей гипотезы не очень хорошо. Но я не унываю. И говорю: а теперь мы внесем замены в син триплеты в зеленой мРНК, т.е. поменяем ее контекст, ее информ. содержание. И синтезируем белок, и неважно, будет он зеленым или утратит свечение. И секвенируем его, чтобы снова проверить коллинеарность. Есть ВЕРОЯТНОСТЬ, что коллинеарности НЕ БУДУТ ВЕЗДЕ СОБЛЮДАТЬСЯ. Это будет говорить в пользу моей гипотезы. Подчеркну, что недостатком такой схемы будет то, что мы, физически меняя син кодоны, делаем это в слепую, поскольку языка генов и их смыслов мы не знаем.

Ас: Тот  вариант гена который я вам дал  - это оптимизированнный вариант  для експрессии в растениях.  И мутант к тому же с  аминокислотной заменой , у него  лучше характеристики  чем у нативного зеленого белка.  меньше агрегирует   и  возбуждение сдвинуто почти на 100нм,  тогда как эмиссия  та же самая , зеленый свет.

Но это все не суть , ген рабочий  и белок на нем рибосома синтезирует   и он светится как и задумано.

Прекрасный обьект для ваших эспериментов  по обнаружению  разума у рибосомы.   Вот поставьте  рибосоме задачку  которую  она может решить  только при наличии у нее разума.  согласно вашей теории  контекстного кодирования




Asterix 22.06.2019 21:05
Ну ... да , надо наверное выяснить что вы подразумеваете пи таблицей генкода зеленой медузы... Вы реально думаете что у зеленой медузы другой совсем код? Ну или даже немного отличный от общепринятой таблицы кода?



Рекрут 22.06.2019 23:25
https://www.bioinformatics.org/jambw/2/3/Tr...tionTables.html ( https://www.bioinformatics.org/jambw/2/3/TranslationTables.html )
The following genetic codes are described here:
 1. The Standard Code
 2. The Vertebrate Mitochondrial Code
 3. The Yeast Mitochondrial Code
 4. The Mold, Protozoan, and Coelenterate Mitochondrial Code
and the Mycoplasma/Spiroplasma Code
 5. The Invertebrate Mitochondrial Code
 6. The Ciliate, Dasycladacean and Hexamita Nuclear Code
 9. The Echinoderm and Flatworm Mitochondrial Code
 10. The Euplotid Nuclear Code
 11. The Bacterial, Archaeal and Plant Plastid Code
 12. The Alternative Yeast Nuclear Code
 13. The Ascidian Mitochondrial Code
 14. The Alternative Flatworm Mitochondrial Code
 16. Chlorophycean Mitochondrial Code
 21. Trematode Mitochondrial Code
 22. Scenedesmus obliquus Mitochondrial Code
 23. Thraustochytrium Mitochondrial Code
 24. Pterobranchia Mitochondrial Code
 25. Candidate Division SR1 and Gracilibacteria Code
 26. Pachysolen tannophilus Nuclear Code
 27. Karyorelict Nuclear
 28. Condylostoma Nuclear
 29. Mesodinium Nuclear
 30. Peritrich Nuclear
 31. Blastocrithidia Nuclear

Вот их сколько. И постоянно расшифровывают новые. Все они близки, но кодоны не всегда совпадают по семантике. Диалекты, словом. Так что мой вопрос естественный - у медузы Aequorea victoria с "зеленым гЕном" Таблица кода известна? Иначе как искать коллинеарности?

Таблицы Генетического Кода медузы Aequorea victoria здесь не нашел.



Рекрут 22.06.2019 23:54
Из параллельно темы

Ас: нарисуйте эсперимент который подтвердит или опровергнет вашу гипотезу о контекстном кодировании аминокислот..

Ну неужели так сложно .. Что мне самому за вас эту работу делать..

Пишите две версии гена ... с разными кодонами и какие ожидаете измеримые эффекты...

Возьмите в работу именно значимые для активного центра аминокислоты... чтоб сразу видно было светится или не светится.

Простой , изящный эксперимент. Нарисуйте эсперимент который подтвердит или опровергнет вашу гипотезу о контекстном кодировании аминокислот..

Ну неужели так сложно .. Что мне самому за вас эту работу делать..

Пишите две версии гена ... с разными кодонами и какие ожидаете измеримые эффекты...

Возьмите в работу именно значимые для активного центра аминокислоты... чтоб сразу видно было светится или не светится.

Простой , изящный эксперимент.

ПГ: НЕ ПРОСТОЙ. Не говоря уже о том, что таблицы ген. кода этой медузы нет. По крайней мере, я не нашел. Уже без этого ничего не нарисуешь. Но даже если бы была, то см. возникающие проблемы. Повторю их:

Основное уходит от Вас. Написать ДНК последовательность гена не сложно. Ну написал, допустим, и что? Не зная языка генов, логики принятия решения рибосомой как нано биокомпьютером, наверно, вкупе с логикой клетки, которая есть компьютер более высокого ранга... Что я могу предсказать? Пока ничего. Поэтому ограничимся пока скромными, но все таки знаниями, которые позволяют проверить мою гипотезу о некой разумности клеточно-рибосомных актов при биосинтезе белков. При этом я опираюсь на чисто экспериментальные результаты, которые однозначно говорят о квази разумном выборе системы клетка-рибосома-мРНК, выборе нужной аминокислоты (о стопах позже) из двух РАЗНЫХ, которые предоставлены шифровкой сиом кодонов, шифровкой, которая НЕ ОДНОЗНАЧНА (данные Ниренберга и Крика, УФН, 1994г. по сиом кодону UUU. И данными группы Туранова, 2009г., Sciense по сиом кодону UGA). Итак, не тривиальная задачка, скорее всего, в предлагаемом Вами ключе, НЕ РАЗРЕШИМАЯ, отследить не нарушается-ли коллинеарность активной части зеленого гена-мРНК при биосинтезе зеленого белка. При этом надо ориентироваться на таблицу ген. кода именно медузы - производителя зеленого белка, но не на стандартную Таблицу Кода E.coli. Есть таблица ген. кода этой медузы? Уже спрашивал. Допустим, есть. Тогда надо сопоставить Эти Табличные данные с разбивкой мРНК зеленого гена на кодоны (предполагаем, что в зеленой мРНК есть сиом кодоны). Допустим, все получилось по Таблице. Это для моей гипотезы не очень хорошо. Но я не унываю. И говорю: а теперь мы внесем замены в син триплеты в зеленой мРНК, т.е. поменяем ее контекст, ее информ. содержание. И синтезируем белок, и неважно, будет он зеленым или утратит свечение. И секвенируем его, чтобы снова проверить коллинеарность. Есть ВЕРОЯТНОСТЬ, что коллинеарности НЕ БУДУТ ВЕЗДЕ СОБЛЮДАТЬСЯ. Это будет говорить в пользу моей гипотезы. Подчеркну, что недостатком такой схемы будет то, что мы, физически меняя син кодоны, делаем это в слепую, поскольку языка генов и их смыслов мы не знаем.



Asterix 23.06.2019 01:46
Н у вот опять вы мешаете эзотерику с наукой ... Это неправильная смесь.
В основе науки лежит гипотеза и эксперимент ... Вы от них отказываетесь принципиально , поскольку не знаете как оно устроено ... Ну так наука для этого и появилась из эзотерики и разошлась с ней ... чтоб выяснять механизмы и принципы природных явлений и создавать математические модели их описывающие ..

Сделайте модель контекстного кодирования .. это несложно , но я за вас это делать не буду.. из принципа.

И не вешайте вину на зеленую медузу... Этот ген мною переписан уже в генкоде зеленого растения.. и стоит он под промотором растительного вируса и прекрасно работает именно в зеленых растениях ... уже в 10 видах пробовали и везде работает, он прекрасно известен ... Ищите Арабидопсис кодовую таблицу ... это она и есть... но с моими поправками... от Высшего Разума конечно же.



Рекрут 23.06.2019 09:03
Но если Вы точно знаете Таблицу кода сей медузы, то вам должна быть известна покодонная разбивка мРНК этой части гена, ответственной за синтез зеленого белка. И сиквенс этого белка тоже должен быть Вам известен. Тогда дело за малым - проверить коллинеарность мРНК----Зелёный белок. И мы, наконец, получим главный ответ - соблюдается-ли в этом случае коллинеарность.



Рекрут 23.06.2019 11:35
(Asterix @ 23.06.2019 02:46)
Ссылка на исходное сообщение  Н у вот опять вы мешаете эзотерику с наукой ...  Это  неправильная смесь.
В основе науки лежит  гипотеза  и эксперимент ... Вы от них отказываетесь  принципиально , поскольку не знаете  как оно устроено ...  Ну так наука для этого и появилась из эзотерики и разошлась  с ней ... чтоб выяснять механизмы и принципы  природных явлений  и создавать математические модели  их описывающие ..

ПГ: Не отказываюсь, а обращаюсь к тем, что уже поставила Природа и люди. У Природы можно и нужно взять гены, их мРНК и их продукт - белкИ. Если есть сиквенсы мРНК и Белков, то нужно проверить коллинеарность мРНК---БелкИ. Это уже даст много информации для доказательства моих идей, или их опровержения.
Можно воспользоваться  уже имеющимися и опубликованными результатами (их упоминал) - по обнаружению двойного кодирования сиомами разных аминокислот, когда для правильного синтеза белков необходим мРНК-контектный выбор одной аминокислоты и з двух разных. Важна еще одна публикация. О ней говорил, но подробнее. Это работа Лолли и Прюита.

ОТДЕЛЬНО приведу фрагмент из моей статьи о сиомии ген. кода. См. ниже.

As: Сделайте модель контекстного  кодирования .. это несложно , но я за вас это делать не буду.. из принципа.

И не вешайте вину на зеленую медузу...  Этот ген мною переписан уже  в  генкоде  зеленого растения..  и стоит он под промотором  растительного вируса  и прекрасно работает  именно в  зеленых растениях ...  уже в 10 видах  пробовали  и везде работает, он прекрасно известен  ... Ищите  Арабидопсис кодовую таблицу ... это она и есть... но с моими поправками... от Высшего Разума конечно  же.




Рекрут 23.06.2019 12:15
Фрагмент из моей статьи о сиомии ген. кода:

В этом представлении модели генетического кода интересна публикация Лолли и др. https://uwaterloo.ca/biology/people-profiles/susan-j-lolle ( https://uwaterloo.ca/biology/people-profiles/susan-j-lolle ) о возвратной генетике некоторых растений [11]. В этой работе показано, что нет отличий в ДНК последовательностях гена Ler дикого типа и гена HTH мутанта растения Arabidopsis thaliana, отвечающих за прямую связь между биологическими свойствами кутикулы, клеточной адгезией и размножением. арабидопсиса. Авторы пишут: «In every case the sequence of the reverted HTH allele matched the Ler wild-type sequence exactly» (В каждом случае последовательность возвращенного HTH-аллеля точно соответствовала последовательности дикого типа Ler).
Это означает, что Лолли и Прюитт обнаружили эффект возврата к части предковой генетики у Арабидопсиса. Фантастичность этого факта в том, что вернувшийся "дикий" ген и мутантный ген идентичны по последовательностям, что необъяснимо со старых Менделевских позиций. Но это объяснимо с позиций лингвистико-волновой генетики. Почему же один и тот же ген дает разные фенотипические проявления?
Чтобы получить ответ в рамках рассматриваемых коррекций модели белкового кода, необходимо проверить коллинеарности мРНК и их белковых продуктов у дикого и у мутантного генов. Можно предсказать, что последовательности аминокислот продуктов этих генов будут различны. Аминокислотные последовательности будут различаться по аминокислотному составу, поскольку соседствующие ДНК последовательности с 3’ и 5’ концов диких и мутантных генов различны, что даёт вариации контекстов и, соответственно, смыслов одних и тех же кодонов в мРНК диких и мутантных генов. Авторы пишут, что высокий уровень реверсии к дикому типу от мутантного давал на нуклеотидном уровне точный дубликат гена дикого типа, наблюдавшегося в предшествующих поколениях. К сожалению, приводимые авторами последовательности нуклеотидов дикого и мутантного кодирующих участков генома не разделены авторами по кодонам. Но очевидно другое - последовательности ДНК с 3’ и 5’ концов обоих генов различаются, следовательно, контекстуальное содержание их обеих мРНК различно. Это позволяет прогнозировать различающиеся аминокислотные последовательности белковых продуктов обоих «псевдо одинаковых» генов и, естественно, разные морфогенезы кодируемых этими генами областей растения.
Подробный анализ работы Лолли и др. [11], вкупе с исследованием Туранова и др. [4] интересны тем, что их основные результаты подвигают генетику на дополнительные исследования в стратегии генетического кодирования белков. Как видим, тут еще многое надо уточнять. С таких новых позиций в генетике просматриваются возможные угрозы ошибок в рекомбинантных технологиях искусственной гибридизации различных генов, ведущей к семантическому произволу на уровне смыслов мРНК, определяющих выбор и точность кодирования аминокислот и стоп позиций сиом-кодонами. Парадоксальность положения в генетике заключается в том, что за 50 лет существования принятой повсеместно модели белкового кода не проведена масштабная проверка на сотнях белков и со статистикой, проверка коллинеарностей ‘белки --- кодоны мРНК’. Если будут найдены несоответствия стандартной таблице кода для белков E.coli, то это не будет отрицать модель кода М. Ниренберга и Ф. Крика. Это будет означать неисчерпаемость принципов генетического кодирования белков, особенно, в лингвистическом, квази речевом направлении.
Ссылки:
1. Gariaev P.P., 1997, Wave genetic code. Monograph. Institute of Control Sciences of the Russian Academy of Sciences. 107 p. (In Russian).
2. Gariaev P.P., 2009, Linguistic-wave genome. Theory and practice. Monograph. 216 p. (In Russian).
3. Gariaev P.P., 2015, Another Understanding of the Model of Genetic Code Theoretical Analysis. Open Journal of Genetics, 2015, 5, 92-109. Published Online June 2015 in SciRes. http://www.scirp.org/iournal/oigen ( http://www.scirp.org/iournal/oigen ) http://dx.doi.org/10.4236/ojgen.2015.52008 ( http://dx.doi.org/10.4236/ojgen.2015.52008 ) Institute of Quantum Genetics LLC. Moscow, Russia.
4. Turanov A.A. et al., 2009, Genetic Code Supports Targeted Insertion of Two Amino Acids by One Codon. Published 9 January 2009, Science 323, 259 (2009). DOI: 10.1126/science.1164748
5. Crick F., 1988, What mad pursuit. A personal view of scientific discovery, p. 90.
6. Lagerkvist U., 1978, “Two out of Three”: an alternative method for codon reading. Proc. Natl. Acad. Sci. USA., 1978.V. 75. P. 1759-1762.
7. Gariaev P.P., Birshtein B.I., Iarochenko A.M., Marcer P.J., Tertishny G.G., Leonova K.A., Kaempf U., 2001, The DNA-wave biocomputer. “CASYS” – International Journal of Computing Anticipatory Systems (ed. D.M. Dubois), Liege, Belgium, v.10, pp.290-310.
8. Сriсk F., Nierenberg M., 1964. The genetic code. Successes of physical sciences., v.LHHH11. In Russian.
9. Gariaev P., Leonova-Gariaeva E.A., Nonlocal functions of DNA-RNA proteins in brain and Consciousness-Thinking (is being prepared)
10. Rumer Yu.B., 1968, The codification of codons in the genetic code. Reports of the Academy of Sciences of the USSR. (1968) V.183, N 1, P.225-226.
11. Lolle S.J., Jennifer L.V., Young J.M., Pruitt R.E., 2005, Genome-wide non-mendelian inheritance of extra-genomic information in Arabidopsis, Nature, 434:505-09, March 24, 2005.
++++++++++++++++++++
В чем изюминка в работе Лолли и др.? А вот в чем. Мутантный и дикий тип Арабидопсиса имеют один и тот же ген HotHead - нормальный и мутантный, но с одинаковыми ДНК последовательностями, НО дающими совершенно разные морфогенетические проявления!!! Это как же такое может быть? - вскричал старина Мендель. А это новая генетика - отвечаем мы. Именно в этом варианте развития генетических событий происходит перекодировка одного из мутантных кодонов гена HotHead по контекстному механизму. То есть кодон остается одним и тем же, но его смыслы в мутантном и диком типе Арабидопсиса Р АЗЛИЧНЫ!
Это приводит к тому, что мутантный тип Арабидопсиса проводит, казалось бы, немыслимый возврат к нормальному типу. Жаль, что авторы не разобрались с кодонами.
Эта работа говорит о многом, и прежде всего, что таблица ген. кода, с ее 32 сиом-кодонами, ментально динамична. А перекодировки кодонов могут быть управляемыми, если поймём язык генов и смоем управлять транспозициями фрагментов ДНК (транспозонами) и создавать нужные ДНК или РНК контексты. Например, для возврата нормальных смыслов онкогенам. Или создавать нужные контексты для инактивации ретровирусов типа ВИЧ. Инактивировать гены старения и т.д. Кстати, всё это перекликается с известным в эмбриологии т.н. эффектом положения генов в геноме.

Теперь об идее синтеза двух генов. В свете изложенного она не сработает.



Asterix 23.06.2019 15:59
Ну сложно читать когда вы спутываете научные термины и эзотерику..

Вам нужно перевести свою идею о контекстном кодировании аминокислот из разряда эзотерического откровения данного вам свыше в поле смысла науки.

То есть необходима гипотеза и эксперимент . Причем все должно быть просто и наглядно и легко воспроизводимо в любой лаборатории мира.

Как только у вас это получится то вы сразу в дамках , или даже в ферзях.

Поэтому надо поработать на дизайном простого изящного легко воспроизводимого эксперимента.

Рассуждения о разуме Рибосомы, квантовых фантомах и спутанности ДНК всех живых организмов лучше пока убрать... это явно указывает на эзотерическую природу вашей теории. А нам надо сделать ее научным фактом. То есть из холистической сделать детерминистской, как положено в научном методе.

Иначе вы так и останитесь маргиналом -философом рассуждающим о непознаваемости ГенКода.

Эти рассуждения не имеют никакого практического смысла.



Asterix 23.06.2019 16:31
Ну вот вам подсказка ... есть такая аминокислота метионин , у него один единственный кодон, АТГ.. Давайте разрушим фермент который присоединяет метионин к тРНК узнающей этот кодон при синтезе белка и посмотрим как рибосома будет справляться с этой проблемой. Сможет ли она заменить этот кодон на другой , ну на похожий Изолейцин скажем , там и АТЦ, АТА, АТТ.

С точки зрения функции белка этот первый метионин совершенно несущественен и разумная Рибосома должна легко справиться с подобной проблемой. Не помирать же целой клетке из-за подобной мелочи?

Ну принцип понятен? Нужен четкий эксперимент показывающий наличие контекстного Разума у рибосомы.

В случае со стоп-кодонами механизм подобного разума известен , рибосома после стоп кодона идет дальше по РНК и ищет еще одну короткую последовательность которая подтверждает что стоп-кодон настоящий, после чего белок отделяется , если подтверждения нет то белок направляется на деградацию будь он хоть трижды правильный. Поэтому в деле генетической инженерии очень важен терминатор транскрипции который содержит в себе этот сигнал для рибосомы. Ну и промотор тоже важен , он содержит в себе нетранслируемый участок который нужен рибосоме чтобы запустить трансляцию.



vb 23.06.2019 19:01
(Asterix @ 23.06.2019 14:31)
Ссылка на исходное сообщение  Ну вот вам подсказка ... есть такая аминокислота  метионин , у него один единственный кодон,  АТГ.. Давайте разрушим  фермент  который присоединяет  метионин  к тРНК  узнающей этот кодон  при синтезе белка  и посмотрим как рибосома будет справляться с этой проблемой.  Сможет ли она заменить этот  кодон на другой  , ну на похожий  Изолейцин  скажем , там и  АТЦ, АТА, АТТ.

С точки зрения функции белка  этот  первый метионин  совершенно несущественен  и разумная  Рибосома должна легко справиться  с подобной проблемой.  Не помирать же целой клетке из-за подобной мелочи?

Ну принцип понятен?  Нужен четкий эксперимент  показывающий наличие контекстного Разума у рибосомы.

В случае  со  стоп-кодонами  механизм подобного разума известен ,  рибосома после стоп кодона идет дальше  по  РНК и ищет  еще одну короткую последовательность  которая подтверждает  что стоп-кодон настоящий, после чего белок отделяется , если подтверждения нет то белок направляется  на деградацию  будь он хоть трижды правильный. Поэтому в деле генетической инженерии очень важен терминатор  транскрипции  который содержит  в себе этот  сигнал  для рибосомы. Ну и промотор тоже важен , он содержит в себе нетранслируемый участок  который нужен рибосоме  чтобы запустить трансляцию.


lol.gif lol.gif lol.gif
ты открыл петровичу новые горизонты. щас он сгенерирует очередную порцию разумно-флуктуацоннного бреда и включит туда откровения про промотор и терминатор.



Рекрут 23.06.2019 20:11
(Asterix @ 23.06.2019 16:59)
Ссылка на исходное сообщение  Ну  сложно  читать когда вы спутываете  научные термины  и эзотерику..

Вам нужно перевести  свою идею  о контекстном кодировании аминокислот  из  разряда    эзотерического откровения  данного вам свыше  в  поле смысла  науки.

ПГ: никакой эзотерики. Не приписывайте. Просто логика.

То есть необходима  гипотеза  и эксперимент . Причем все должно быть просто  и наглядно  и  легко воспроизводимо  в любой лаборатории мира.

ПГ: Оно бы хорошо бы, да не по рту кусок. Так и будет сложно, а не просто, поскольку не знаем язык генов. Это, надеюсь, уяснили. Вы не понимаете, что экспериментальных результатов, в рамках ваших трактовок никто не получит.  Надо  управлять (но рановато) транспозонами = контекстами, только тогда высветится механизм перекодировок, общие черты которых дал и опубликовал. Эти 2 статьи массово скачивают, но воспринимаются они с трудом, как Вами, например. Ведь вы же по этим статьям ничего возразить не можете, всё эзотерику там ищете, как прошлогодний снег в июле.

Ас: Как только у вас это получится  то вы сразу в дамках , или даже в ферзях.
Поэтому надо поработать на дизайном простого изящного  легко воспроизводимого  эксперимента.

ПГ: Пока не поймем азы смыслов генных текстов, никакой дизайн не возможен. Пока можно искать только нарушения коллинеарностей в дублях мРНК----кодоны белков. Или
ловить эффекты возвратов от мутантных генов к нормальным на уровне виртуальный перекодировок смыслов сиом кодонов, как это было в цитированной статье Лолли и соавт. или искать случаи двойного неоднозначного кодирования, как в статье Туранова и соавт.

Ас: Рассуждения о разуме Рибосомы, квантовых фантомах  и спутанности  ДНК всех живых организмов лучше пока убрать...  это явно указывает на эзотерическую природу вашей теории. 

ПГ: Тогда уберите идеи квантовой нелокальности в теор. физике вместе с их автором - Эйнштейном.

Ас: А нам надо сделать ее научным фактом.  То есть из холистической  сделать  детерминистской, как положено  в научном методе.

ПГ: Так мы и получаем научные факты и анализируем аналогичные, полученные независимо, что цитировал. Вы с ними ознакомились?

Ас: Иначе вы так и останитесь маргиналом -философом рассуждающим о непознаваемости  ГенКода.

ПГ: Грубовато. Но понимаю, Вам надо как-то компенсировать не усвоение  наступающей новой генетики.

Ас: Эти рассуждения не имеют никакого практического смысла.

ПГ: Мы подтверждаем наши идеи практикой. Ссылки давал. Дам и еще, если хотите. В личку. Сюда не крепится, слишком большой объём.






Asterix 23.06.2019 20:22
ты открыл петровичу новые горизонты...

Ну так я же вижу как он учится в процессе образовательной беседы ... да он постоянно включает новые элементы в свою теорию.. И это хорошо... По сравнению с тем что было в начале , когда он только еще приступал к служению Люциферу, - огромный прогресс наблюдается.

Еще немного усилий и будет статья в Натуре... Дайте срок.. До Апреля еще куча времени.



Asterix 23.06.2019 20:32
Петровичь , я вас именно прошу подтвердить ваши идеи практическим экспериментом, который по вашей логике просто невозможен в силу непостижимости замысла главного генного инженера - Бога.

нам нужен простой изящный експеримент с кучей контролей ... иначе мы в приличном журнале вроде Натуры это не опубликуем.

Вы же претендуете на Новую Генетику .. а это уровень [Nature and Science and Cell] Давайте уж соотвествовать требованиям.

Вы же сами понимаете что Бюллетень Екпериментальной Медицины и Биологии публикует сплошной мусор научный, ему доверия нет . Я там тоже публиковался ... стыдно вспомнить. три старушки за компьютерами сидят и ничего более них за душой нет .



Asterix 23.06.2019 20:45
И не надо ссылаться на вульгарные интерпретации квантовой механики и применять их к биологии ... Это не научно. Это непрофессиональный язык.

Там есть прекрасный и логично выстроенный математический аппарат и модели которые описывают реальность в такой степени что на этих описаниях построена целая индустрия электроники и космоса.

Когда эти модели начинают интерпретировать простым человеческим языком для непосвященных в тайны математики - начинается всякая чушь вроде дуализма волна-частица и квантовой нелокальности ... Эти идеи заимствоиваны в эзотерике , поскольку так проще , хоть что-то можно обьяснить. По крайней мере оно выглядит более человечно.

У вас нет новой модели Генетического Кода ... так вот сделайте, и давайте ее проверять, экспериментальным научным путем.



Рекрут 23.06.2019 20:49
(Asterix @ 23.06.2019 17:31)
Ссылка на исходное сообщение  Ну вот вам подсказка ... есть такая аминокислота  метионин , у него один единственный кодон,  АТГ.. Давайте разрушим  фермент  который присоединяет  метионин  к тРНК  узнающей этот кодон  при синтезе белка  и посмотрим как рибосома будет справляться с этой проблемой.  Сможет ли она заменить этот  кодон на другой  , ну на похожий  Изолейцин  скажем , там и  АТЦ, АТА, АТТ.

ПГ: Ну вот видите, сразу обнаруживается Ваше непонимание. Кодирование метионина осуществляется одним из сиом кодонов семейства АТ, а именно  АТГ.  Чтобы убедиться в способности рибосомы к виртуальной перекодировке, надо поступить изящнее - заменить АТГ на  АТЦ или АТА или АТТ, то есть поменять на вируально вобулирующий (по Ф.Крику) 3'-нуклеотид - Г на нуклеотиды Ц, А, Т. В таком раскладе рибосома должна будет воспринимать  эти кодоны как шифрующие изолейцин.Так? Так. Но рибосоме, прочитавшей контекст мРНК, это явно не понравится, контекст, который говорит - нужен нуклеотид Г и только Г. И тогда рибосома ВИРТУАЛЬНО заменяет обозначения Ц, А, Т на Г. И включает в растущую цепь пептида МЕТИОНИН. Ошибка исправлена. Как втом примере записки: "Маша, я забыл коГ своего компа. Помоги вспомнить." Маша читает и понимает, что в слове коГ надо мысленно (виртуально) заменить Г на Д. Вот и вся премудрость лингвистики генома.

Ас: С точки зрения функции белка  этот  первый метионин  совершенно несущественен  и разумная  Рибосома должна легко справиться  с подобной проблемой.  Не помирать же целой клетке из-за подобной мелочи?
Ну принцип понятен?  Нужен четкий эксперимент  показывающий наличие контекстного Разума у рибосомы.

ПГ: Я его и описал.

Ас: В случае  со  стоп-кодонами  механизм подобного разума известен ,  рибосома после стоп кодона идет дальше  по  РНК и ищет  еще одну короткую последовательность  которая подтверждает  что стоп-кодон настоящий, после чего белок отделяется , если подтверждения нет то белок направляется  на деградацию  будь он хоть трижды правильный. Поэтому в деле генетической инженерии очень важен терминатор  транскрипции  который содержит  в себе этот  сигнал  для рибосомы. Ну и промотор тоже важен , он содержит в себе нетранслируемый участок  который нужен рибосоме  чтобы запустить трансляцию.

ПГ: Видите, опять текст-подтверждение нужен. Типа: "валяй, останавливай синтез" smile.gif




Рекрут 23.06.2019 21:58
(Asterix @ 23.06.2019 21:32)
Ссылка на исходное сообщение  Петровичь , я вас именно прошу подтвердить ваши идеи практическим экспериментом, который по вашей логике просто невозможен в силу непостижимости замысла  главного генного инженера  -  Бога.

ПГ: Почему невозможен. Получали же люди, не слабые люди, И результаты не слабые. Приводил. Но Вы их как бы не замечаете. Они, правда, от этого не исчезают.

Ас: нам нужен простой изящный експеримент  с кучей контролей  ... иначе мы в приличном журнале  вроде  Натуры  это не опубликуем.

ПГ: Вот в Натуре и опубликованы результаты по гену HotHead. И давненько о них тут говорил. Так что просто развиваю те идеи, которые еще в 1997г. опубликовал в монографии "Волновой генетический код". Идеи о двукратной вырожденности ген. кода.

Ас: Вы же претендуете на Новую Генетику .. а это уровень  [Nature  and  Science  and Cell]  Давайте уж соотвествовать требованиям.

ПГ: Вот и поставьте эксперимент с кодоном Метионина. И разберитесь с кодированием Лейцина. Будет еще пара доказательств в пользу новой генетики.

Ас: Вы же сами понимаете что Бюллетень Екпериментальной Медицины и Биологии публикует сплошной мусор научный, ему доверия нет . Я там тоже публиковался ... стыдно вспомнить.  три  старушки за компьютерами сидят  и ничего более них за душой нет .

ПГ: Это старая песня. Истина не зависит от места публикации. Кстати, Open.J. of Genetics, где опубликовал последние две статьи, приличный журнал. Просят прислать еще в том же направлении сиомии ген. кода. Написал, отослал, но в другой журнал, где включил вероятностную модель в функциях генома.




Рекрут 23.06.2019 22:08
(Asterix @ 23.06.2019 21:45)
Ссылка на исходное сообщение  И не надо ссылаться на вульгарные интерпретации квантовой механики  и применять их к биологии ... Это не научно.  Это  непрофессиональный язык.

ПГ: Вы бы, как не профи в квант. физике, не трогали бы её...

Ас: Там есть прекрасный и логично выстроенный математический аппарат  и модели которые описывают реальность  в такой степени  что на этих описаниях построена целая индустрия  электроники  и космоса.

ПГ: Рекомендовал уже моногр. С.И.Доронина, специалиста по квантовому компьютингу, под названием "Квантовая магия". Там бы увидели как сливается кв. физика с эзотерикой, но на пользу дела, а не демонов. Есть в сети.

Ас: Когда эти модели начинают  интерпретировать  простым человеческим языком  для непосвященных  в тайны математики    - начинается всякая чушь  вроде дуализма  волна-частица  и квантовой нелокальности  ...  Эти идеи  заимствоиваны в эзотерике , поскольку так проще , хоть что-то можно обьяснить. По крайней мере оно выглядит  более человечно.

ПГ: Не мудрите, уже отвечал на это.

Ас: У вас нет новой модели Генетического  Кода ...  так вот сделайте,  и давайте ее проверять, экспериментальным  научным путем.

ПГ: Уже приводил и наши экспер-ты, и независимые. Без толку. Ни объяснить их не можете, ни опровергнуть. Зашли в тупик.




Asterix 24.06.2019 03:04
Ну вот уже хоть что-то у вас стало получаться , наконец-то ..

То есть вы предлагаете заменить в гене зеленого флюоресцентного белка первый кодон метионина на один из его сиомкодонов изолейцин и утверждаете что рибосома обнаружит проблему, найдет решение исходя из контекста РНК , что это должен быть первый метионин белка и поставит туда именно метионин а не изолейцин? И далее просто прочтет всю рамку как обычно. И такой мутантный ген будет давать белок который будет светиться как и обычно?

Ну что ж , это будет явно необьяснимо с позиций классического кода.. Метионин в одной позиции , а именно в самой первой кодируется изолейцином и вполне может принести вашей теории признание в Натуре.

Вот это уже будет не эзотерика, а наука.



Рекрут 24.06.2019 08:50
Рамка считывания зеленой мРНК разбита покодонно? Если это сделали, дайте ссылку, пожалуйста.



Рекрут 24.06.2019 09:05
Ас: Вот это уже будет не эзотерика, а наука.

ПГ: Можете поставить этот эксперимент? У Вас есть биохим. кухня, у меня ее нет.



Asterix 24.06.2019 13:02
Sequences alignment:
> - 720 nucleotides
Translation in forward direction:

DNA: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggac
+1fr: MetValSerLysGlyGluGluLeuPheThrGlyValValProIleLeuValGluLeuAsp


DNA: ggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctac
+1fr: GlyAspValAsnGlyHisLysPheSerValSerGlyGluGlyGluGlyAspAlaThrTyr


DNA: ggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccacc
+1fr: GlyLysLeuThrLeuLysPheIleCysThrThrGlyLysLeuProValProTrpProThr


DNA: ctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaag
+1fr: LeuValThrThrLeuThrTyrGlyValGlnCysPheSerArgTyrProAspHisMetLys


DNA: cagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttc
+1fr: GlnHisAspPhePheLysSerAlaMetProGluGlyTyrValGlnGluArgThrIlePhe


DNA: ttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctg
+1fr: PheLysAspAspGlyAsnTyrLysThrArgAlaGluValLysPheGluGlyAspThrLeu


DNA: gtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcac
+1fr: ValAsnArgIleGluLeuLysGlyIleAspPheLysGluAspGlyAsnIleLeuGlyHis


DNA: aagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaac
+1fr: LysLeuGluTyrAsnTyrAsnSerHisAsnValTyrIleMetAlaAspLysGlnLysAsn


DNA: ggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgcc
+1fr: GlyIleLysValAsnPheLysIleArgHisAsnIleGluAspGlySerValGlnLeuAla


DNA: gaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccac
+1fr: AspHisTyrGlnGlnAsnThrProIleGlyAspGlyProValLeuLeuProAspAsnHis


DNA: tacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtc
+1fr: TyrLeuSerThrGlnSerAlaLeuSerLysAspProAsnGluLysArgAspHisMetVal


DNA: ctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa
+1fr: LeuLeuGluPheValThrAlaAlaGlyIleThrLeuGlyMetAspGluLeuTyrLysOc*



Asterix 24.06.2019 13:08
Ну вот продвинулись .. сначала надо детализацию сделать , для эксперимента , что именно надо изменить в гене и что мы ожидаем от этого изменения .

Будут 2 гипотезы , одна на основе классической модели кода , а другая на основе вашей модели контекстного кодирования. И будет ожидаемый результат, с позиции каждой теории мы предскажем его.

И тогда можно будет и эксперимент сделать. Это несложно технически.



Asterix 24.06.2019 13:15
То есть Вы предлагаете поменять первый АТГ на один из 3 изолейциновых кодонов и утверждаете что согласно вашей теории рибосома исходя из контекста эту подмену заметит и поставит туда метионин и таким образом сама определит себе правильную рамку считывания РНК. В результате получится функциональный белок , который будет давать зеленую флюоресценцию как и обычный , который без этой замены первого кодона.

Давайте все детали обговорим сначала и все предсказания сделаем с позиции классической и вашей теории кода. Ну и контроли какие будем делать?



Рекрут 24.06.2019 15:51
(Asterix @ 24.06.2019 14:15)
Ссылка на исходное сообщение  То есть Вы предлагаете  поменять первый  АТГ  на   один из  3 изолейциновых кодонов  и утверждаете  что согласно вашей теории  рибосома   исходя из контекста  эту подмену заметит  и поставит  туда  метионин  и таким образом сама определит себе правильную рамку считывания  РНК.  В результате  получится функциональный белок  , который будет давать  зеленую флюоресценцию как и обычный ,   который без этой замены  первого кодона.

Давайте все детали обговорим сначала   и все предсказания сделаем с позиции  классической  и вашей теории кода.  Ну и контроли какие будем делать?

АТГ - экзотический сиом кодон начала синтеза белков. Этим отличается от других сиом.
Имеет смысл взять другой сиом из рамки ГАЦ или ТТЦ, тем более, они кодируют по КолИной таблице - Asp и Ser. Это будет дополнительный опыт и одновременно контроль на экзотику и уникальность, свойственную только АТГ, с которого начинаются синтезы белков. В сиомах ГАЦ и ТТЦ тоже поменять 3' вобулирующие нуклеотиды на не свои. Если я (мы) правы, то включаться будут прежние табличные аминокислоты, т.е. внесенные ошибки будут исправлены в соответсвии с контекстом мРНК Если не правы, включаться будут, хоть и Табличные, но другие аминокислоты, т.е. ошибки не исправлены, контекст не работает, по крайней мере в рамках данного эксперимента .



Asterix 24.06.2019 17:43
ТТЦ - это фенилаланин, но не суть.

Начинать надо с самого главного кодона , с первого метионина , уж у него-то контекст точно есть , причем очевидный и очень важный контекст - рамка считывания называется , и уж если он не даст ожидаемого результата, то чего на остальные смотреть.

Вот классическая теория ГенКода в данном конкретном случае предсказывает что если заменить АТГ на любой изолейциновый кодон АТХ.. то она будет просто тупо искать следующий АТГ и конечно же его найдет, он там есть , но не в той рамке что нужна , запустит трансляцию РНК в пептид и довольно быстро обнаружит в этой рамке другой стоп-кодон , но не найдя подтверждения ему, что он настоящий , просто сбросит то что насинтезировала в утиль и просто уйдет с этой РНК . С другой рибосомой повторится та же история.. В результате никакого зеленого белка в клетке не появится.

А по вашей теории все будет совсем по другому, рибосома увидит что первый АТГ подменили на изолейцин и спокойно исправит ошибку и синтезирует тот самый белок.

Таким образом все получится солидно и в Натуре подобную работу вполне примут к Публикации. Ну хотя бы в виде короткого сообщения .



Asterix 24.06.2019 18:40
Вот в поддержку семантики и лингвистики , сегодня 2 часа озвучивал фильм , дело в Мурманске происходит там и снимали , но озвучивали в Бельгии, местные русскоязычные , многие из которых уже сильно с акцентом говорят.. режиссер кстати сын одного крупного менеджера из фарм бизнеса...

Так вот среди прочего мне надо было переозвучить неудачную предыдущую озвучку фразы , ее местный чеченец до этого озвучивал , получился дикой кавказскои акцент -

// Америка , Германия,
Расскажи лучше про свою девочку
--Это лучшая история ---//

причем надо было это сказать в таком издевательском тоне .. Ну представьте себе , Мурманск , вечер , какие-то жилые сараи , снег .. я в роскошной рыжей собачьей шубе гуляю не менее роскошную собаку в цвет к шубе. И вижу местного шизофреника , он ключник, типа слесарь по замкам, двери людям вскрывает когда ключи потеряны, и постоянно с кем-то разговаривает , с выдуманными им персонажами что отвлекает его от суровой действительности этого города.

И вот мне надо над ним поиздеваться , ибо это его внутренний голос такой.

И вот я ему проходя мимо должен что-то высказать в уничижительном тоне. Не состарадательном, а вот именно припечатать.

Выяснилось что я не могу эту фразу так как надо сказать без модификации лингво-кода...
Только вот так у меня и получилось.
// Америка Германия,
Лучше про бабу свою расскажи
--Это твоя лучшая история -- //

причем /твоя/ практически и не слышно но без этого слова ничего не получается, речевой аппарат так устроен , очень странно он работает.

Потом была еще одна фраза

тоже сложно было ..

///Блядь , Я писаю на свою обувь что ли?//

Ну а с немецкой фразой вообще замучился , надо было сказать с русским акцентом где-то в Мурманске. очень медленно

[Das ist meine auto]

Ну вообщем веселое это дело - лингвистика и семантика.

Завтра пойду на премьеру фильма в нашем кинотеатре, аж два сеанса у него будет , в присутсвии режиссера. Надеюсь успеет последную редакцию сделать к премьере.



Рекрут 24.06.2019 22:16
Понятно. Вкусили чужеродную ДНК.

Вот Вам супер эзотерика в ореоле ДНК https://www.proza.ru/2019/06/20/1122 ( https://www.proza.ru/2019/06/20/1122 )

Насчет того, что рибосома "соскочит", прочитав бред стоп-контекста. Не очевидно.

И в добавок для большего ДНК кайфа https://www.youtube.com/watch?v=2lbJausq7lE&t=3509s ( https://www.youtube.com/watch?v=2lbJausq7lE&t=3509s )



Asterix 25.06.2019 00:23
Ну вот . изучаете же эзотерику ... Там другой мир знания и науке он неподвластен. Вот его контекст , мира эзотерики. Там все очень логично и голову ломать над эскпериментами совершэнно незачем.

Кратко освещены понятия: Древо Жизни, Меркаба, Катара, Темплата Первоосновы Создания, 15-мерная Матрица, Млечный Путь, Андромеда, Червячные Дыры, Чёрные Дыры, Каббала, Атлантида, Лимурия, 3-х мерная Реальность, инкарнация, гармонический ряд, ченеллинг, чакра, Метатрон, Архангел Михаил, Ануннаки, Нефилимы, Тот, Изумрудные Скрижали, Хроники Акаши, Прецессия Равноденствия, Весика Пайсис, Фибоначчи, Чандлеровское Колебание, Морфогенетическое Поле, Квантовая Физика, Скалярная Волна, Атомная Трансмутация, Трансмиграция, Транслокация, Тёмная Материя, Торсионное Поле, история Земли, история галактики Млечный Путь, НЛО, Нью-Эйдж, Новый век, Кундалини, Духовность, Душа, Дух, Поле Единого Сознания Бога-Истока



Asterix 25.06.2019 00:57
вот вам пример как надо научно подходить к делу контекстного кодирования , без эзотерики и квантовых фантомов. Я похоже вас таки подвел этому моменту истины , научной истины.

http://www.jbc.org/content/264/9/5031.long ( http://www.jbc.org/content/264/9/5031.long )

[The ability of mammalian ribosomes to initiate translation at triplets other than AUG emphasizes the complexity of eucaryotic translation initiation sites and adds to the clear and growing evidence that sequences in the vicinity of an initiation codon contribute to its ability to function in trans- lation initiation.
Since non-AUG triplets are normally ignored by the translation initiation apparatus, the occurrence of initiation events at such sites indicates that sequences outside the initiation codon must play a role. This expectation has been borne out experimentally.
The initiator consensus se- quence originally defined by Kozak (11, 15-17) is clearly an important determinant of the efficiency with which AUG and non-AUG triplets are recognized as initiation codons.

Since initiation at a non-AUG triplet requires base mis- match at the level of the codon-anticodon interaction, the efficiency with which some non-AUG triplets are recognized as initiation codons is a little surprising.
In vivo ACG is utilized with as much as 10-15% the efficiency of AUG in some experiments. This is an error frequency that would be intolerable during the elongation phase of protein synthesis. Since some base mismatches seem to be tolerated remarkably well, it is clear that the interaction between the codon and anticodon cannot be an over-riding determinant of the fidelity of initiation codon recognition. As mentioned above, sequence context helps define an initiation site.
Moreover, a high degree of fidelity is apparently introduced into the initiation process at the level of ternary complex formation (eukaryotic initia- tion factor 2-GTP-tRNAMet). Methionine is the initiating amino acid regardless of which triplet is being utilized, because tRNAF is probably the only species able to gain access to the initiation site. These considerations allow the require- ments for precise codon-anticodon interaction to be less strin- gent than those which operate during elongation.
The different efficiencies of utilization of the various non- AUG triplets suggest that some nucleotide mismatches are less destabilizing than others. It has been recognized for many years that codon-anticodon interactions can involve uncon- ventional base pairing schemes that render certain mis- matches tolerable.
This was the basis of Crick's wobble hypothesis which predicted alternative base pairing schemes for the third position of some codons (31).
Other unusual base pairing schemes have also been discussed relative to the fidelity of codon-anticodon interaction (32). The possibility of additional unconventional base pairs has been inferred from studies of natural suppressor tRNAs (33), from analysis of the secondary and tertiary structures of ribosomal RNAs (34) and tRNAs (35, 36), and from the three-dimensional structures of mismatched synthetic duplex oligodeoxyribo- nucleotides (37-39).
Some of these unconventional base pairs may form during initiation at the non-AUG triplets examined in this study. Unfortunately, the current state of knowledge of the destabilizing effects of specific single base mismatches in RNA seems insufficient to permit one to conclude whether the strength of the codon-anticodon interaction is the sole determinant of the relative initiation efficiencies of the non- AUG triplets.
Moreover, conformational constraints imposed on the anticodon by the secondary structure of tRNA, and by the environment of the ribosome itself, may make it difficult to extrapolate directly from studies of model oligonucleotides. However, we can point out that some positions of the initiator triplet are more sensitive to substitution than others.
Thus, the third position is relatively insensitive to substitution, each of the mutations being tolerated about equally well.
The first position can also be altered without eliminating the ability to serve as an initiator, although C is clearly favored over U or G. The second position is more sensitive to substitution and cannot tolerate the presence of a purine residue, even though a C at this site yields the most efficient of all the non-AUG initiation codons tested in this study.
There are at least two potential advantages in the ability to initiate translation at sites other than AUG. 1) Since initiation at a non-AUG triplet is generally less efficient than at AUG, it could provide a means for negatively modulating the synthesis of a protein that is required (or tolerated) only in small quantities.
2) Initiation at a non-AUG triplet situated upstream of an initiator AUG provides a mechanism for the production of more than one protein from a single mRNA.
In some instances this has been accomplished by altering the sequence context of an AUG to reduce its efficiency and thus reveal the presence of a downstream initiation codon. The synthesis of virion proteins 2 and 3 of SV40 is an example of such a mechanism.
However, the same goal can be accom- plished by the use of a non-AUG initiator triplet. So far only a few examples of translation initiation at naturally occurring non-AUG triplets have been reported. Adeno-associated virus initiates translation of a capsid pro- tein with ACG (7). An ACG is apparently also used as an initiation codon for the C' protein of Sendai virus (8, 9). ]



Asterix 25.06.2019 01:05
Как вы можете заметить научные эксперименты по инициированию трансляции с других кодонов никак не подтверждают вашу идею... Инициирующие Кодоны могут сильно отличаться от вами предсказанных сиомов.

Вот даже интересно , неужели вы эту статью не читали? это же 1989 год .. и еще куча других потом была но ничего особо нового в контекстном кодировании не обнаружили..

Феномен существует , но к синонимам и омонимам по вашей версии Кода очень слабо соотносится.

Вот как красиво он водит читателей за нос там... прям гениально водит. И не подкопаешься ...
[As observed previously (ll), the non-AUG triplets appear to be much less efficiently recognized in vivo than in vitro, but the overall hierarchy of efficiencies is similar.
ACG was the most efficient, followed by CUG, AUC, AUU, and AUA. No full-length DHFR was detected when GUG, UUG, AAG, or AGG was the initiator triplet.
No species is present which might correspond to initiation at internal positions as was seen in vitro (Figs. 2 and 3). Perhaps this truncated form of DHFR is rapidly degraded in vivo. We cannot exclude the alternative possibility that the AUG at codon 15 is not recognized as an initiation site by ribosomes in vivo.]



Рекрут 25.06.2019 08:54
Не вижу в этих рассуждениях конкретной мысли, исключающей мою гипотезу. Фактически, это лишь подтверждает мою основную идею, что геном уникальных последовательностей ДНК - это динамические тексто-смысловые игры, в частности, игнорирующие обязательность AUG как зачинщика синтеза белков, смысл которого контекстно зависим. Вот и вся сермяга.



Asterix 25.06.2019 13:31
динамические тексто-смысловые игры - это философское обобщение не требующее доказательств , его не опубликуешь как вывод из научных экспериментов. Это пустое множество.

Давайте вот лучше вместе внимательно почитаем эту статью и отметим все звоночки указывающие на недобросовестность автора работы ( ну помино того что это апрельский номер журнала)

Я уже отметил интересную фразу которая выглядит как редакционное требование рецензента и которая запросто обьясняет все результаты по-другому . Комар носа не подточит. И научная формальность соблюдена. Мол есть и другое обьяснение нашим результатам, но оно какое-то слишком уж простое и неинтересное , и мы не стали этот вопрос исследовать и сосредоточились на том что нам большэ по душе.

[We cannot exclude the alternative possibility that the AUG at codon 15 is not recognized as an initiation site by ribosomes in vivo.]

Вообще там огромное поле для тренировки студентов на [scientific bullshit]. Просто отличная статья.



Asterix 25.06.2019 13:45
Я так понимаю что вам будет удобнее если я на русской переведу английский текст из статьи? или и так понимаете?

Там куча интересной именно для рассуждений о ГенКоде информации. В частности вот и обсуждения неопределенности соотвествия кодон-аминокислота.

However, we can point out that some positions of the initiator triplet are more sensitive to substitution than others.
Thus, the third position is relatively insensitive to substitution, each of the mutations being tolerated about equally well.
The first position can also be altered without eliminating the ability to serve as an initiator, although C is clearly favored over U or G. The second position is more sensitive to substitution and cannot tolerate the presence of a purine residue, even though a C at this site yields the most efficient of all the non-AUG initiation codons tested in this study.



Рекрут 25.06.2019 16:10
(Asterix @ 25.06.2019 14:31)
Ссылка на исходное сообщение  

Ас: динамические тексто-смысловые игры  -  это философское обобщение не требующее доказательств ,  его не опубликуешь  как вывод  из научных экспериментов. Это пустое множество.

ПГ: Гипотеза, до ее доказательства или опровержения, не может являться пустым множеством. Как не может быть таковым язык, которого не понимаешь. А язык генов именно таков. Пока мы понимаем только три сиом кодона - TGA, TAA, TAG как  слова синонимы - СТОП, СТОЙ, ЗАКАНЧИВАЙ. И это уже проявления тексто-смысловых структур последовательностей ДНК и РНК. Но Язык ДНК - табу для генетики, хотя Ф.Крик первым назвал ДНК текстом, но использовал это как МЕТАФОРУ, не более. Хотя уже первое открытие группы Ниренберга, ясно показало, что кодон UUU имеет двойную, омонимическую семантику и он означает одновременно Фенилаланин и Лейцин. Тут бы и задуматься... Где там, Нобелевская Ниренбергу маячила совсем близко. И они с Крикомsmile.gif отделались пустым - нам-де непонятна молекулярная природа этого явления. Учитесь, как можно отказаться от собственного крупнейшего открытия. А научных экспериментов, доказывающих текстовость и смысл генов уже достаточно, дополненных чисто логическим доказательством (Гаряев и др.), и использующим экспериментальные результаты, не до конца понятые авторами (группа Ниреберга, работа Лолли и соавт, статья Туранова и соавт. Ссылки давал.) 


Ас: Давайте вот лучше вместе внимательно почитаем эту статью  и отметим все звоночки  указывающие на недобросовестность  автора работы  (  ну помино того что это апрельский номер  журнала). Я уже отметил  интересную фразу  которая выглядит как  редакционное требование рецензента  и которая запросто обьясняет  все результаты  по-другому .  Комар носа не подточит.  И научная формальность  соблюдена.  Мол есть и  другое объяснение  нашим результатам, но оно какое-то  слишком уж простое и неинтересное , и мы не стали этот вопрос исследовать  и сосредоточились на том что  нам большэ по душе.

[We cannot exclude the alternative possibility that the AUG at codon 15 is not recognized as an initiation site by ribosomes in vivo.]

ПГ: А где Вы видите "звоночки"?

Вообще там огромное поле для тренировки студентов на  [scientific bullshit]. Просто отличная статья.

ПГ: Еще раз ссылку на эту статью, если не трудно




Рекрут 25.06.2019 16:27
(Asterix @ 25.06.2019 14:45)
Ссылка на исходное сообщение  Я так понимаю что вам будет удобнее  если я на русской переведу  английский текст  из  статьи?  или и так понимаете?

Там куча интересной именно для рассуждений о ГенКоде  информации.  В частности  вот  и обсуждения  неопределенности  соотвествия кодон-аминокислота.

However, we can point out that some positions of the initiator triplet are more sensitive to substitution than others.
Thus, the third position is relatively insensitive to substitution, each of the mutations being tolerated about equally well.
The first position can also be altered without eliminating the ability to serve as an initiator, although C is clearly favored over U or G. The second position is more sensitive to substitution and cannot tolerate the presence of a purine residue, even though a C at this site yields the most efficient of all the non-AUG initiation codons tested in this study.


ПГ: Важно, что инициирующий кодон ATG является сиом кодоном, и понятно поэтому, что третья позиция (Гуанин) наиболее чувствительна к заменам, тут ничего нового. Первые две позиции (кодирующий дублет сиома) тоже чувствительны. Это как бы новый результат. Но на то и есть сиом кодон, чтобы быть объектом перекодировок даже при заменах по первым двум позициям. В чем вопрос-то?



Рекрут 25.06.2019 22:02
Просматриваю внимательно Вашу ссылку http://www.jbc.org/content/264/9/5031.long ( http://www.jbc.org/content/264/9/5031.long ) ,
рекомендованную Вами, как пример работы с не AUG инициирующими кодонами, и нахожу, по сути, подтверждение идеи контекстных перекодировок. Великолепная работа. Позже дам выдержки из неё.
А вообще, работ по этой теме бездна

https://yandex.ru/search/?clid=9582&text=In...&l10n=ru&lr=213 ( https://yandex.ru/search/?clid=9582&text=Initiation%20at%20Non-AUG%20Triplets&l10n=ru&lr=213 )

Беглый просмотр показывает, что контекст-перекодировочные мотивы, похоже, в статьях отсутствуют. То есть отсутствует понимание, а почему такие замены AUG работают? В этом смысле то, что предлагаю экспериментально проверить, в лучшем случае дополнит предшествующие работы. Тут фишка в объяснении этого феномена, его биологического смысла.

Вот характерный фрагмент из рекомендованной статьи:

"Поскольку инициация в триплете, отличном от AUG, требует несовпадения оснований на уровне взаимодействия кодон-антикодон, эффективность, с которой некоторые триплеты, не являющиеся AUG, распознаются как кодоны инициации, является немного удивительной.
В некоторых экспериментах ACG in vivo используют до 10-15% эффективности AUG. Это частота ошибок, которая была бы недопустимой во время фазы удлинения синтеза белка. Поскольку некоторые несоответствия базы, по-видимому, замечательно переносятся, ясно, что взаимодействие между кодоном и антикодоном не может быть определяющим фактором достоверности распознавания инициирующего кодона. Как упоминалось выше, контекст последовательности помогает определить сайт инициации.
Более того, высокая степень верности, по-видимому, вводится в процесс инициации на уровне образования тройного комплекса (эукариотический фактор инициации 2-GTP-tRNAMet). Метионин является инициирующей аминокислотой, независимо от того, какой триплет используется, потому что tRNAF, вероятно, является единственным видом, способным получить доступ к сайту инициации. Эти соображения позволяют сделать требования к точному кодон-антикодонному взаимодействию менее строгими, чем те, которые действуют во время удлинения."



Asterix 26.06.2019 02:06
Ну там же есть оговорка что все результаты можно обьяснить по-простому , там есть еще один первый АТГ кодон в рамке через 15 кодонов от первого .. и эта простейшая версия не была исследована в статЬе.
Ну и судя по заявленимям про 40 сантиметровые гели и картинке удивительно нереальной для таких гелей .. вывод напрашивается сам .. С 1 Апреля.



Asterix 26.06.2019 02:09
Ну и автор постоянно путает прокариот с эукариотами ... но тоже очень так профессионально их запутывает ... прям как фотоны.. Это красивый научный юмор , мне понравился.

Вот еще один свежий пример научного юмора от [Nature] ... давно так не хохотал ... красиво сделали. Там самое главное - это ссылки... Тоже прекрасный учебный материал для студентов , чтоб потом сами могли дерьмо научное от жемчуга отличать... И интуицию бы вырабатывали , что не всему что публикуют в серьезных даже журналах можно доверять. Шутников-то в науке пруд пруди.

https://www.nature.com/articles/s41591-019-0485-4 ( https://www.nature.com/articles/s41591-019-0485-4 )



Рекрут 26.06.2019 07:52
(Asterix @ 26.06.2019 03:06)
Ссылка на исходное сообщение  Ну там же есть оговорка  что все результаты можно обьяснить  по-простому  , там есть  еще один первый АТГ кодон  в рамке  через  15 кодонов  от первого ..  и эта  простейшая версия не была исследована в статЬе.
Ну и судя по заявленимям про  40  сантиметровые гели    и картинке  удивительно  нереальной  для таких гелей .. вывод  напрашивается сам ..  С 1 Апреля.

Вряд-ли журнал пошел по шутливой линии. А отдаленный от первого АТГ кодон, так сие не меняет главного. Это означает перемены в текстах мРНК, и соответственно, в их смыслах. То есть все те же тексто-ментальные операции. Поймите, на генах и их мРНК нет ничего, кроме текстов и их смыслов. А кодирование сиом кодонами основано на, если не тотальной, то массовой ВИРТУАЛЬНОЙ деколлинеаризации. Простите за косноязычное звучание этого стратегического фактора. Выглядит и впрямь забавно - AUG поменяли, а новый, не AUG, ведет себя виртуально, как AUG. Для старой генетики это, действительно, как первоапрельская хохма. Особенно ярко это можно высветить, в буквальном смысле, на зеленом белке при не AUG инициирующих кодонах в нашем варианте. В этом случае, если получится, можно дать, как объяснение, версию мРНК контекст зависимости. Давно напрашивается. Даже акад. РАН Л.П.Овчинников, Директор Института белка РАН, шептком smile.gif (в Соросовском просветительском журнале!) сообщил о "втором генетическом коде", связанным с контекстными манипуляциями в мРНК (ссылку давал, но могу повторить). Громко говорить об этом боятся.smile.gif Также как не насмелятся увидеть массовые деколлинеарности мРНК----БелкИ при статистически значимом сопоставлении. Искал много - ничего не нашел. Может, кто видел?



Рекрут 26.06.2019 10:37
To Asterix: Так что, будем ставить эксперимент?



vb 26.06.2019 14:26
(Рекрут @ 24.06.2019 07:05)
Ссылка на исходное сообщение 
ПГ: Можете поставить этот эксперимент? У Вас есть биохим. кухня, у меня ее нет.



(Рекрут @ 25.06.2019 14:10)
Ссылка на исходное сообщение  



(Рекрут @ 26.06.2019 05:52)
Ссылка на исходное сообщение  Искал много - ничего не нашел. Может, кто видел?



(Рекрут @ 26.06.2019 08:37)
Ссылка на исходное сообщение  To Asterix: Так что, будем ставить эксперимент?


Вот собственно, суть петра петровича: абсолютный импотент шакплит, вдруг ктото дрогнет и за него поставит эксперименты для подтверждерия его бреда.
работать не пробовал, выбегалло?



Asterix 26.06.2019 14:41
Ну я же вас уже подвел к нужной точке сборки и тонко намекаю, а вы похоже не понимаете ... все нужные эскперименты уже сделаны и даже опубликованы , дело за малым , критически разобрать статью , выделить из нее очевидные научные ляпы , коих там полно и переписать эту статью как новое исследование уже без этих ляпов ... Так чтоб - Комар носа не подточит - . Эта тема о странности генкода , она вечная, и подобную работу перелицованную на новый лад с удовольствием возьмут в апрельский номер.

Повторить эту работу нереально , ну кто будет работать с радиоактивной меткой нынче и гонять 40 сантиметровые гели и прочее там такое... Надо новую работу нарисовать. С теми же результатми но без технических ляпов.

Нужно именно в простом современном формате ту же самую сказку пересказать читателю. И только наличие в ссылках ваших публикаций по Волновой Генетике будет единственным колокольчиком который подскажет читателю суть этой статьи.


Вот давайте рисуйте для начала самый первый экперимент .. синтез вариантов ГФП согласно вот той статье про дигидрофолат редуктазу ... далее нам нужно будет смотреть на активность зеленого белка , будем делать в растениях , это точно никто воспроизводить не станет и всегда можно отмазку сделать, я нарисую фотки у меня полно ГФП растений есть.

Ну и пойдем далее ... Надо предусмотреть отсуствие второго АТГ в рамке рядом с первым, чтоб рецензенты не морочили нам голову потом.

Потом нам надо нарисовать масс-спек амино-концевого пептида... естесвенно чтоб все правильно было, первые 5-6 аминокислот вполне достаточно чтоб показать наличие метионина . То есть это будет неопровержимым доказательством что другие кодны в позиции первого метионина кодируют метионин и никак иначе.

Масс-спек лучше рисовать поскольку это никто воспроизводить не станет , дорого слишком . Что нам и требуется .

Но можно пойти и по другому пути, вставить после первых 5 амимокислот сайт для протеазы ФакторХ например или любую другую которая подойдет. Тогда мы сможем после дериватизации просто порезать белок и вытащить дериватив амино-концевого пептида и его отсиквенировать по Едману. Тут надо будет взять в долю еще одного участника который согласится нарисовать нужные спектры и картинки.

Ну давайте работaть .. пишите , будем вместе редактировать .



Asterix 26.06.2019 14:52
Dear VB ,
ну мы ведем светскую беседу ... что вы злитесь-то? корову что ли продаете? Петрович вполне себе в русле зарубежной мысли в области чудесных свойств ДНК кода , он не одинок.
В Науке всегда есть место юмору , как впрочем и то что в любой шуткэ есть доля шутки.

То что кроме метионина есть и другие инициирующие кодоны - это научный факт. Но вот смелая гипотеза про то что они кодируют метионин не будучи метиониновыми кодонами - это смелое утверждение . Это шаг вперед в деле дешифровки ГенКода.

Высказывайте лучше свои соображения по экспериментам ... Вас эти эсперименты никто делать не заставляет. Это прекрасный и осмысленный проект для биохакерской лаборатории.

Вот почитайте этого юмориста и покритикуйте его ... как надо бы правильно сделать подобные експерименты. http://www.jbc.org/content/264/9/5031.long ( http://www.jbc.org/content/264/9/5031.long )



Рекрут 26.06.2019 15:08
Извините, но чушь какую-то предлагаете, да еще в первоапрельский номер.
Идея и постановка ясна. Ставьте. Я дам теорию. И не забудьте посоветоваться с vb. Он большой шутник на букву м.
Впрочем, проводить экспериментальную работу в обсуждаемом ключе довольно бессмысленно.
Таких данных уже множество. Все дело в трактовке, в теории. Их как не было, так и нет. Это беру на себя. Хотя vb, наверно, напишет лучше. smile.gif А Вы могли бы обзор опубликованных работ дать. Такую работу можно было бы подать в J.theoret. biology.



Рекрут 26.06.2019 15:19
Ac: Вот почитайте этого юмориста и покритикуйте его ... как надо бы правильно сделать подобные експерименты. http://www.jbc.org/content/264/9/5031.long ( http://www.jbc.org/content/264/9/5031.long )

ПГ: Где Вы увидели юмор в этой статье?



Поклонник Талантов 26.06.2019 15:41
user posted image



Asterix 26.06.2019 23:01
ПГ: Где Вы увидели юмор в этой статье?

Ну там же ошибка на ошибке ... и подтасовка и передергивание и вообще картинки не соотвествуют тому что на них заявлено. Ну и апрельской же номер. Одни 40см белковые гели чего стоят .. это +5.

Мне лично прикольно было читать и разбираться .. А давайте не побоимся ответственности и сделаем сиквел этой статьи.. нУ на современный лад . Благо уже 30 лет прошло ... автор наверное уже мертв и сраму не имет .. и на права не будет претендовать... Алцгеймер у него в последней стадии ... живой труп.



Рекрут 26.06.2019 23:31
(Asterix @ 27.06.2019 00:01)
Ссылка на исходное сообщение  ПГ: Где Вы увидели юмор в этой статье?

Ну там же ошибка на ошибке ... и подтасовка  и передергивание и вообще картинки не соотвествуют  тому что на них заявлено. Ну и апрельской же номер.  Одни 40см белковые гели чего стоят .. это +5.

Мне лично прикольно  было читать и разбираться .. А давайте не побоимся  ответственности  и сделаем сиквел  этой статьи..  нУ на современный лад .  Благо  уже  30 лет прошло ... автор  наверное уже мертв и сраму не имет ..  и на права не будет претендовать...  Алцгеймер  у него  в последней стадии ...  живой  труп.

Может быть, но в итоге получил результат, который повторили многие. Давайте, разберите экспериментальную часть, здесь Вы эксперт, а я по теор. части напишу. Куда? В Cell или в J. theor. biol.?



Asterix 26.06.2019 23:46
Ну сначака надо вашу теорию немного подредактировать .. а то из этих результатов третья позиция в кодоне совсем не особая . это может быть и вторая и первая.

напишите полный список сиом кодонов и ваши предположения насчет их стабильности в плане замены отдельных букв кода.. Я а посмотрю что мы имеем в зеленом белке для экспериментальных замен и задавания вопросов рибосоме по трансляции генкода в белок.



vb 27.06.2019 06:34
(Asterix @ 26.06.2019 12:52)
Ссылка на исходное сообщение  Dear  VB ,
ну мы ведем светскую беседу ... что вы  злитесь-то? корову что ли продаете?  Петрович вполне себе в русле  зарубежной мысли  в области  чудесных свойств  ДНК кода , он не одинок.

Нуну, продолжайте.
а давайте, раз уж у вас много свобоного воемени и доступ к оборудованию, вы лучше займетесь подтверждением его лазерныз фантомов?
там же все просто -праймеры, матрица, пцр и лазер.

А то петр петрович в последнее время не вспоминает об этом. Все норовит в более глубокие и ресурсоемкие темы зарыться, а то и вообще от экспериментов откреститься, чтобы его никто не уличил в подтасовке.



Рекрут 27.06.2019 11:44
(Asterix @ 27.06.2019 00:46)
Ссылка на исходное сообщение  Ну сначака надо вашу теорию немного подредактировать  ..  а то из этих результатов  третья позиция в кодоне  совсем не особая  . это может быть  и вторая и первая.

напишите  полный список сиом кодонов и ваши предположения насчет их стабильности  в плане замены отдельных букв кода.. Я а посмотрю что мы имеем в  зеленом белке  для  экспериментальных замен и  задавания вопросов  рибосоме  по трансляции генкода  в белок.

Не особая... Поэтому и предлагал не метиониновый сиом, чтобы увидеть его особость или не особость. Впрочем, на третьем эффективнее работает, что не случайно и важно.

И еще. Сделать автора очень старой статьи объектом критики за методические недочеты - не лучшая идея. Логичнее было бы сделать кратенький обзор статей, безупречных в экспериментальном плане и однозначно доказывающих, что 3-й нуклеотид сиома вобулирует с целью перекодировки триплета в соответствии с контекстом мРНК. И если его заменить, а функция зеленого белка остается, смысл 3-го (заместителя) возникает как делегированный контекстом в сторону нужного нуклеотида для сохранения белковой функции. Меняется по схеме: пишется Лондон, читается (понимается) - Жмеринка. smile.gif Кстати, это еще одно доказательство устойчивости генетической информации не только по син. кодонам, но и по сиомам. Причем, в сиом варианте защита тройная - по третьему, второму и первому нуклеотидам метионинового сиом кодона. Так что заменяемость второго и первого логична и демонстративна.



Рекрут 27.06.2019 12:08
(Asterix @ 27.06.2019 00:46)
Ссылка на исходное сообщение  Ну сначака надо вашу теорию немного подредактировать  ..  а то из этих результатов  третья позиция в кодоне  совсем не особая  . это может быть  и вторая и первая.

напишите  полный список сиом кодонов и ваши предположения насчет их стабильности  в плане замены отдельных букв кода.. Я а посмотрю что мы имеем в  зеленом белке  для  экспериментальных замен и  задавания вопросов  рибосоме  по трансляции генкода  в белок.

Подредактировал, дополнил в смысле тройной устойчивости сиом (напр., от мутаций) См. предыдущий ответ. А список сиом не нужен. Он в таблице ген кода в нашей статье https://file.scirp.org/pdf/OJGen_2018061114211334.pdf ( https://file.scirp.org/pdf/OJGen_2018061114211334.pdf )
Стабильность сиом в плане замены нуклеотидов по 1 и 2 позициям надо смотреть по статьям. Или проверять самим.



Рекрут 27.06.2019 12:24
(vb @ 27.06.2019 07:34)
Ссылка на исходное сообщение  Нуну, продолжайте.
а давайте, раз уж у вас много свобоного воемени и доступ к оборудованию, вы лучше займетесь подтверждением его лазерныз фантомов?
там же все просто -праймеры, матрица, пцр и лазер.

А то петр петрович в последнее время не вспоминает об этом. Все норовит в более глубокие и ресурсоемкие темы зарыться, а то и вообще от экспериментов откреститься, чтобы его никто не уличил в подтасовке.

Нет, не даром в 2004 году, когда появился в Беседе и тут же этот г-н vb бросил в мою сторону (но попал в себя) конечный продукт своего метаболизма, не даром у меня первая реакция была - Vo bliad'... За прошедшие 15 лет он всё та же форумная bliad'. mad.gif , которая сиплым голосом поёт одни и те песни все эти 15 лет.
Это уже хроническая мозговая болезнь, но можем помочь, используя наши технологии. smile.gif



Asterix 27.06.2019 15:21
Петрович, берите пример с меня , я же не перехожу на мат и личные оскорбления ... Не всегда нужно вестись на провокации и отвечать тем же. Мы же научную беседу ведем, а не на базаре рыбой торгуем... Держите марку академического ученого. В МГУ же как никак учились.


///

Итак , цитата, --- в сиом варианте защита тройная - по третьему, второму и первому нуклеотидам метионинового сиом кодона. Так что заменяемость второго и первого логична и демонстративна.--

Вот пишите список из трех ваших самых замечательных сиом кодонов и распишите во что они могут превращаться то есть какие перекодировки , виртуальные , вы их называете, перекодировки , рибосома может им давать?

Я так понимаю что в новой редакции вашей теории, согласно вот упомянутым выше экспериментальным данным, сиом АТГ может быть практически любым по составу букв и все равно кодировать метионин если он стоит в первой позиции белка? не так ли? Или таки он ограничен?

Нам нужно расписать четкий научный эксперимент именно для вашей теории .. Просто слова о динамической перекодировке и связка ДНК-РНК-Рибосома как голографический синтронный квази-компьютер в приличном журнале не прокатят , нужны эспериментальные факты.



Рекрут 27.06.2019 20:03
(Asterix @ 27.06.2019 16:21)
Ссылка на исходное сообщение  Петрович, берите пример с меня , я же не перехожу на мат  и личные оскорбления ...  Не всегда нужно вестись на провокации  и отвечать тем же. Мы же научную беседу ведем,  а не на базаре рыбой торгуем... Держите марку академического ученого.  В МГУ же как никак учились.
///

ПГ: слово bliad, использованное мной, близко к Немецкому das blut, английскому  blood, норвежскому blodet, то есть КРОВЬ. У нас, Русских, оно перекодировано в ругательство. Шире смотреть надо - на истоки языковых кодов . Это академичнее.  vb, пытается из форума фактически сделать кровавую бойню, как мне кажется, что не хорошо.

Ас: Итак  ,  цитата, --- в сиом варианте защита тройная - по третьему, второму и первому нуклеотидам метионинового сиом кодона. Так что заменяемость второго и первого логична и демонстративна.--
Вот пишите список из  трех ваших самых замечательных сиом кодонов  и  распишите во что они могут превращаться  то есть  какие перекодировки , виртуальные ,  вы их называете,  перекодировки  , рибосома может им давать?

ПГ: Почему список из трех сиом кодонов, когда их 32? (См. Табл. ген. кода в нашей статье).
Наглядно и удобно, для понимания моих соображений, это представлено в Таблице ген. кода (красными буквами) в нашей статье, где прямо демонстрируются перекодировки кодонов методом делегирования смыслов от контекста мРНК на рибосомный квази интеллект и далее на генетический смысл сиом кодонов  https://file.scirp.org/pdf/OJGen_2018061114211334.pdf ( https://file.scirp.org/pdf/OJGen_2018061114211334.pdf ) 
Кто не понял, еще раз модельный пример как бы генетического текста: "Маня, я забыл коГ своей эл. почты". Рибосома-Маня, прочитав, понимает, что надо мысленно (виртуально) неправильное, бессмысленное слово коГ читать и понимать как коД. Иными словами буква Г физически не переписывается Маней-рибосомой, но мысленно переделывается на букву Д. Также переделывается, виртуально меняется третья буква - нуклеотид  в сиом кодоне метионина. А также, в меньшей степени, вторая и первая. Словосочетание "в меньшей степени" будет означать, что частоты включений метионина в начало растущей пептидной цепи зеленого белка будут меньше, по сравнению с заменами нуклеотидов по второй и первой позициям. Это хорошая поправка к моей сиом-текстовой модели белкового кода, основанная на экспериментах, которые Астериксу вряд-ли имеет смысл повторять, по крайней мере для сиом кодона метионина.

Ас: Я так понимаю  что в новой редакции вашей теории,  согласно  вот упомянутым выше  экспериментальным данным,  сиом АТГ может быть  практически  любым  по  составу букв  и все равно кодировать  метионин  если он стоит  в первой позиции  белка? не так ли?  Или таки он ограничен?

ПГ: Никакой новой существенной редакции моей теории нет. Есть поправки тактического уровня. Стратегическая редакция дана мной еще в 1997г. в монографии "Волновой генетический код" (есть в Сети), где на базе известных экспер. данных и модели кода Ниренберга-Крика, обосновано стратегическое положение о двойной синонимо-омонимической вырожденности белкового кода. Это положение вводит ментальную (текстовую) составляющую в модель биосинтеза белков. Это  импульс к развитию новой генетики, хотят-ли этого vb-подобные или не хотят. Такова Природа. С ней не поспоришь на форумах. 

Ас: Нам нужно расписать четкий  научный эксперимент именно  для вашей теории  .. Просто  слова  о динамической перекодировке  и связка  ДНК-РНК-Рибосома  как голографический синтронный квази-компьютер    в приличном журнале не прокатят , нужны  эспериментальные факты.

ПГ: Экспериментальные факты уже есть, разве что повторить и развить их на очень демонстративном зеленом белке. Эффективнее было бы сделать краткий обзор экспериментов в таком духе и дать теорию в более четком виде. А спинтронные эффекты при ген. кодировании нами продемонстрированы экспериментально. И защищена кандидатская Николаем Кокая в 2012г., принятая ВАКом. Правда, Николай не использовал пугающих биологов слов - спинтроника, квантовый нанобиокомпьютинг и т.д. Это взял на себя в расчете на будущее понимание.smile.gif




vb 27.06.2019 20:17
а куда будете неонкой светить?
с неонкой красива будет. натура примет.

хотя, судя по терминологии гаряева, вам нужно в филологический журнал подаваться. подумайте, может того этого? в филологические говнометарии подадитесь?



Рекрут 27.06.2019 20:37
(vb @ 27.06.2019 21:17)
Ссылка на исходное сообщение  а куда будете неонкой светить?
с неонкой красива будет. натура примет.

хотя, судя по терминологии гаряева, вам нужно в филологический журнал подаваться. подумайте, может того этого? в филологические говнометарии подадитесь?

Отмечу только интеллектуальное убожество vb. И отвечать ему далее не буду. Все и так видят, кто есть кто.



Asterix 27.06.2019 22:38
цитата..--- буква Г физически не переписывается рибосомой, но мысленно переделывается на букву Д. Также переделывается, виртуально меняется третья буква - нуклеотид в сиом кодоне метионина. А также, в меньшей степени, вторая и первая. Словосочетание "в меньшей степени" будет означать, что частоты включений метионина в начало растущей пептидной цепи зеленого белка будут меньше, по сравнению с заменами нуклеотидов по второй и первой позициям. Это хорошая поправка к моей сиом-текстовой модели белкового кода.----
///////
Ну нам надо как-то придти к экспериментальной модели ... чего толку теоретизировать о квази-рибосомном разуме . Это непубликабельно в приличном научном журнале.

Нам нужно эспериментальное доказательство бытия этого рибосомного Квази-Разума,

Нужэн эксперимент с четким выводом по результату анализа. Есть Квази-Разум у Рибосомы или таки она глупа как утка и ничего в тексте ДНК не соображает вообще. Как какая-нибудь умная машинка для чтения текстов ... Читает, но не понимает что читает. В отличие от человека который понимает что он читает.



Рекрут 27.06.2019 23:49
Ас: Ну нам надо как-то придти к экспериментальной модели ... чего толку теоретизировать о квази-рибосомном разуме . Это непубликабельно в приличном научном журнале.

Нам нужно эспериментальное доказательство бытия этого рибосомного Квази-Разума,

Нужэн эксперимент с четким выводом по результату анализа. Есть Квази-Разум у Рибосомы или таки она глупа как утка и ничего в тексте ДНК не соображает вообще. Как какая-нибудь умная машинка для чтения текстов ... Читает, но не понимает что читает. В отличие от человека который понимает что он читает.

ПГ: Существует довольно большое количество статей в рамках идеи о том, геном является биокомпьютером. Тем более, наш мозг.

Вот на вскидку:

http://www.rexresearch.com/biophotons/TheD...ocomputer10.pdf ( http://www.rexresearch.com/biophotons/TheDNAWaveBiocomputer10.pdf )
https://alexfl.ru/vechnoe/vechnoe_dnk.html ( https://alexfl.ru/vechnoe/vechnoe_dnk.html )
Математика ген кода http://tekhnosfera.com/view/436101/a?#?page=15 ( http://tekhnosfera.com/view/436101/a?#?page=15 )
https://creationist.in.ua/reading/quote/280...herbaka-makukov ( https://creationist.in.ua/reading/quote/280-scherbaka-makukov )
https:// https://www.technologyreview.com/s/400727/d...1/dna-computing ( https://www.technologyreview.com/s/400727/dna-computing/studylib.net/doc/7636591/dna-computing )
https://www.technologyreview.com/s/400727/dna-computing/ ( https://www.technologyreview.com/s/400727/dna-computing/ )
http://www.rexresearch.com/biophotons/TheD...ocomputer10.pdf ( http://www.rexresearch.com/biophotons/TheDNAWaveBiocomputer10.pdf )

Можно еще дать...

Так что насчет неопубликабельности, это Вы зря...



Рекрут 28.06.2019 00:02
А теоретизировать надо и всегда было надо, но с учетом экспериментальных работ.

И подтверждать теор. положения чистым экспериментом, как, к примеру, в нашей работе с генетиками о программируемом влиянии человеческой речи на репаративные функции генома растений:

http://ukr.rusphysics.ru/files/Garyaev.Ver....modulyacii.pdf ( http://ukr.rusphysics.ru/files/Garyaev.Verbalnosemantich.modulyacii.pdf )



Asterix 28.06.2019 00:27
Петровичь ,есть куча мест где публикуются эзотерические работы ... вы вот сами привели их целый список... Это не проблема , я вам с самого начала сказал что вы принадлежите к области эзотерики и там совершэнно прекрасно во все вписываетесь. И никаких научных экспериментов вам в принципе и не нужно. Теории можно и без экспериментов придумывать.

Но если вы хотите сделать научную публикацию , то от языка и терминов очевидно эзотерического характера лучше отказаться .. Надо сделать все в научном стиле , ну то есть надо замаскироваться под науку ... ох господи , уже не знаю как доходчивее вам это обьяснить... эзопов язык совершенно не воспринимаете похоже, а все о контексте ДНК текста рассуждаете.

Чтоб публиковать в научном журнале - это должно быть похоже на науку, хотя бы внешне похоже . Нужны четкие гипотезы и эксперименты и ясные выводы из этих экспериментов. И без эзотерики ... она может там быть в виде глубоко скрытого в самой структуре ядра, но невидимого обычным взглядом. На вид - это должна быть рядовая научная работа.



Рекрут 29.06.2019 00:14
(Asterix @ 28.06.2019 01:27)
Ссылка на исходное сообщение  Петровичь ,есть куча мест где публикуются эзотерические работы ... вы вот сами привели их целый список...  Это не проблема , я вам с самого начала сказал  что вы принадлежите к  области эзотерики и там совершэнно прекрасно во все вписываетесь.  И никаких научных экспериментов вам в принципе и не нужно.  Теории можно и без экспериментов придумывать.

Но если вы хотите сделать научную публикацию , то от языка  и  терминов  очевидно эзотерического характера  лучше отказаться ..  Надо сделать все в научном стиле ,  ну то есть надо замаскироваться под науку ... ох господи , уже не знаю как доходчивее вам это обьяснить...  эзопов язык совершенно не воспринимаете похоже,  а все о контексте ДНК текста рассуждаете.

Чтоб публиковать в научном журнале  - это должно быть похоже на науку,  хотя бы внешне похоже .  Нужны четкие гипотезы  и эксперименты и  ясные выводы  из этих экспериментов. И без  эзотерики ... она может там быть  в виде глубоко скрытого  в самой структуре  ядра, но невидимого обычным взглядом. На вид  - это должна быть рядовая научная работа.

Генетической лингвистике свойственны все понятия обычной лингвистики, которая не эзотерична. Такова и генетическая лингвистика. Если не хотите совместной работы, напишу сам. Благодарю Вас за ссылку.



Поклонник Талантов 29.06.2019 13:25
ВМЕСТО ПРЕДИСЛОВИЯ, ИЛИ КАК ВСЁ НАЧИНАЛОСЬ
Всѐ началось как обычно, с женщины. Мама решила воспользоваться антресолью и обнаружила, что это невозможно по причине еѐ полнейшей захламлѐнности и указала «своим мальчикам» на недопустимость, неприемлемость и вообще, доколе?! Полезли разгр***. Хотели взять и скопом всѐ выбросить, но снова вмешалась мама, приказала перед отправкой барахла на мусорку, проверить его на наличие пригодных в хозяйстве вещей. Мысль здравая, на дворе стояли, как теперь принято политкорректно говорить, лихие девяностые и в дело шло буквально всѐ. И вот в процессе поиска, я наткнулся на коробку с голограммами.
Голограммы, это старинное хобби папы, причѐм на столько, что он наверное один из лучших специалистов в этом вопросе, с Басовым и Прохоровым за руку здоровался. Вообще, по жизни, он учѐный, от звонка до звонка на службе МО СССР, дослужился до полковника и занимался проблемами распространения сигналов. Правда, с большинством его работ не смог ознакомиться даже я со своей первой формой. То, что вы сможете найти в открытом доступе, это лишь коммерческие проекты, к науке отношения не имеющие. Единственное, если в детстве вас водили на выставку голограмм орденов и медалей СССР, их как раз и делал мой отец.
Привыкнув, что голограмма это нечто прикольное, принялся их с интересом рассматривать, однако тут меня ждало разочарование, вместо занятных картинок, на пластинах были записаны странные концентрические окружности. Естественно, возник вопрос – это что?
- Глаз кролика – просветил меня папа.
- В смысле?
- В прямом. Берѐтся кролик, выдирается у него глаз и пока он, если можно так сказать, жив, записывается голограмма.
- Э…, это как?
- Если ты про вырванный глаз, без понятия. Этим занимался профессиональный хирург из академии. Всѐ остальное, точно так же как при снятии голограммы с обычного предмета.
- А нафига?
- Без понятия, сверху спустили приказ – сделать. Приехал ответственный человек с кроликами и инструментом, от меня только сама голограмма. Если бы мне нужно было знать зачем, довели бы дополнительно.
- А всѐ же?
...



Asterix 29.06.2019 14:26
Ох Петрович, истину глаголете,
---Генетической лингвистике свойственны все понятия обычной лингвистики, которая не эзотерична. Такова и генетическая лингвистика...---

Ну кто бы спорил что в конечном итоге мы живем в мире слов , и без слова мы не способны даже увидеть предмет им обозначаемый. Я очень люблю эти теории возникновения сознания основанные на слове , на речи. И это действительно наука , но в той науке другие понятия и термины ... которые очень отдаленно связаны с генетикой.

Да, наше сознание 100% зависит от слова.

Но в генетике это не катит, увы. Тексты ДНК изучаются по другому . При помощи экпериментов.

Пэтому я прдлагаю вам разработать концепт Простого Универсального Кодона и нарисовать научное исследование которое подтверждает этот концепт научным же методом , путем самого обычного эксперимента.

Савайте введем в Волнивую Генетиуку понятие Универсальный Кодон .. который может кодировать любую аминокислоту ... Информация о значении этого УК считывается рибосомой позиционно и не зависит от состава букв в нем .. Самый удобный кандидат на эту должность - это именно АТГ метионин, поскольку он первый кодон и он определяет контекст , рамку считывания. Если она его не увидит то белка не будет.

Мы выдвинем гипотезу что рибосома считывает не АТГ, а позицию +31 от конкретного короткого сигнала в 5-начале мРНК , соотвественно что бы не маходилось в позициях 31,32, 33 оно рибосомой прочитывается как первый метионин белка и начало рамки считывания кода. Ну а далее рибосома уже не думает а просто тупо наращивает пептидный текст пользуясь однозначным соотвествием кодонов и аминокислот согласно всем известной таблице ГенКода. Ну иногда может и ошибается и не ту аминокислоту включает но в силу структуры кода эти замены ни на что особо не влияют.

Вот такая гипотеза прекрасно поддается экспериментальной проверке, и если нам удастся это показать на практике то это будет очень добротная научная публикация. И такую статью очень несложно нарисовать как я уже выше вам рассказывал.

И заметЬте , никакой внешней эзотерики в этом нет ... я ее скрыл и замаскировал очень глубоко и хорошо... ни один рецензент не догадается что это на самом деле.



Рекрут 29.06.2019 20:16
(Asterix @ 29.06.2019 15:26)
Ссылка на исходное сообщение  Ох Петрович,   истину глаголете,
---Генетической лингвистике свойственны все понятия обычной лингвистики, которая не эзотерична. Такова и генетическая лингвистика...---

Ну кто бы спорил  что в конечном итоге мы живем в мире  слов , и без  слова мы не способны даже увидеть предмет им обозначаемый.  Я очень люблю эти теории возникновения сознания основанные на слове  , на речи.  И это действительно наука  , но в той науке  другие понятия  и термины ...  которые очень отдаленно  связаны с генетикой.

Да, наше сознание 100% зависит  от слова. 

Но в генетике  это не катит, увы.  Тексты  ДНК  изучаются  по другому .  При помощи экпериментов.

Пэтому я прдлагаю вам   разработать концепт  Простого  Универсального  Кодона  и  нарисовать  научное исследование которое подтверждает  этот концепт   научным же методом , путем самого обычного эксперимента.

Савайте  введем в Волновую Генетику  понятие    Универсальный Кодон ..  который может кодировать  любую аминокислоту ... Информация о значении этого  УК  считывается рибосомой   позиционно  и не зависит от  состава букв  в нем   ..  Самый удобный кандидат на эту должность  - это именно  АТГ  метионин, поскольку он первый кодон  и он определяет контекст  , рамку считывания.  Если она его не увидит  то белка не будет.

Мы выдвинем гипотезу  что  рибосома считывает не АТГ,  а позицию  +31   от   конкретного  короткого сигнала  в 5-начале  мРНК , соотвественно  что бы не маходилось  в позициях  31,32, 33    оно рибосомой прочитывается как  первый метионин  белка и начало рамки  считывания кода.  Ну а далее рибосома уже не думает  а просто тупо наращивает  пептидный текст  пользуясь однозначным соотвествием   кодонов  и аминокислот  согласно всем известной таблице ГенКода. Ну иногда может и ошибается и не ту аминокислоту  включает   но в силу  структуры кода  эти замены  ни на что особо не влияют.

Вот такая гипотеза  прекрасно поддается экспериментальной проверке, и если нам удастся это показать  на практике  то  это будет очень добротная научная публикация.  И такую  статью  очень несложно  нарисовать  как я уже выше вам рассказывал.

И заметЬте  , никакой  внешней эзотерики  в этом нет ... я ее скрыл  и замаскировал    очень  глубоко и хорошо... ни один  рецензент не догадается   что это  на самом деле.

Об этом думал и даже высказывал идею на квантум форуме, но там специалистов нет, кроме двух, один из которых уже почил. Но ставил вопрос шире, и наверно, сыровато. Идея: любой сиом триплет может (контектуально-зависимо) шифровать все 20 аминокислот, включая СТОПы. Потом бросил думать, предварительно утомив соображалку. Теперь Вы меня вернули на эту колею. Дедуктивный посыл здесь таков. Сиомы, по своей природе, в своих возможностях, функционально полиморфны и, теоретически, с легкостью могут перекодировываться на все 20 аминокислот, манипулируя семантикой первых, вторых и третьих нуклеотидов, и присваивая (делегируя) им комбинаторику значений букв A,U,G,С в любых вариациях. Если так, то преимущества в духе Ин-Янь очевидны. Простите за вклинившуюся (для служебного пользования) эзотерику. С одной стороны появляется невероятная приспособительная и, пардон снова, "соображательная" гибкость при мощном биосинтезе коротко живущих белков нейронов, которые в совокупности реально мыслят. Эта же гибкость и находчивость для иммунных ответов на уровне иммуноглобулинов по схеме графиков Ву-Кэбота. С другой стороны, сохраняется первородная невинность исходных ДНК последовательностей белковых генов, не распространяемая на "лёгкое поведение" мРНК (еще раз прошу извинить smile.gif). Тогда термин "универсальный кодон" можно будет заменить на словосочетание "универсальность сиом "
Жду возражений.



Asterix 30.06.2019 01:56
Ну теоретически, у вас все было правильно , но нам нужна конкретика и подавать ее надо под научным соусом, без очевидной эзотерики..

Давайте разработаем детально пока только концепт первого Универсального Кодона и посмотрим какие эксперименты нам нужны и какие мы ожидаем результаты чтоб эту работу приняли в печать.

Все это нарисовать несложно , но надо четко понимать что, куда, и зачем .. нужна логика во всем этом.. Остальное - дело техники.



Рекрут 30.06.2019 08:41
(Asterix @ 30.06.2019 02:56)
Ссылка на исходное сообщение  Ну теоретически, у вас все было правильно , но нам нужна конкретика  и подавать ее надо под научным соусом, без очевидной эзотерики..

Давайте разработаем детально  пока только концепт  первого  Универсального Кодона  и посмотрим какие эксперименты нам нужны   и какие мы ожидаем результаты  чтоб эту работу  приняли в печать.

   Все это нарисовать несложно , но надо четко понимать  что, куда, и зачем .. нужна логика  во  всем этом.. Остальное  - дело техники.

Ну давайте хотя бы первый эскиз экспериментов. Только по сиому метионина основное уже давно получено. Можно менять нуклеотиды по всем трем позициям без смены метионина, как результат смен 1-3 нуклеотидов, на другую аминокислоту, но с количественными небольшими вариациями. Спасибо контексту мРНК. Что-то хотите добавить?



Asterix 30.06.2019 14:17
Все эти прошлые исследования сильно грешат в плане доверия к результатам, там множество ляпов.
Я предлагаю сделать абсолютно безгрешное исследование , с Революционными воистину результатами. ... Которое можно будет подвергнуть критическому сомнению только если у критика найдутся деньги на воспроизведение нашей работы. В современном научном мире - это самый главный вопрос , Где деньги и кто финансирует. В свое удовольствие никто не инвестирует капиталы.

А если и найдется такой критик с деньгами .. то у нас завяжется с ним плодотворная дискуссия о Едином Универсальном Кодоне в которой ваше имя Петрович будет постоянно на виду у широкой научной общественности.

Сейчас нам нужна консультация специалиста по рибосоме , как научно оформить этот контекст мРНК который который рибосома узнает на 5-конце и который определяет начало трансляции по позиционному механизму , независимо от значения Первого Кодона.

Ну то есть вот как такое в принципе возможно прдставить себе на практике ? так чтоб коллеги бы тоже поверили в такой механизм.

Только без квантовых фантомов и спинтронного излучения. Мы сделаем все просто как все остальные учэные молбиологи делают.



Asterix 30.06.2019 16:38
заначит так , для затравки Давайте рассмотрим классическую схему работы рибосом.

...Ribosomes are the workplaces of protein biosynthesis, the process of translating mRNA into protein. The mRNA comprises a series of codons which are decoded by the ribosome so as to make the protein.

Using the mRNA as a template, the ribosome traverses each codon (3 nucleotides) of the mRNA, pairing it with the appropriate amino acid provided by an aminoacyl-tRNA. Aminoacyl-tRNA contains a complementary anticodon on one end and the appropriate amino acid on the other. For fast and accurate recognition of the appropriate tRNA, the ribosome utilizes large conformational changes (conformational proofreading) .[39]

The small ribosomal subunit, typically bound to an aminoacyl-tRNA containing the first amino acid methionine, binds to an AUG codon on the mRNA and recruits the large ribosomal subunit.

The ribosome contains three RNA binding sites, designated A, P and E. The A-site binds an aminoacyl-tRNA or termination release factors;[40][41] the P-site binds a peptidyl-tRNA (a tRNA bound to the poly-peptide chain); and the E-site (exit) binds a free tRNA.

Protein synthesis begins at a start codon AUG near the 5' end of the mRNA. mRNA binds to the P site of the ribosome first. The ribosome recognizes the start codon by using the Shine-Dalgarno sequence of the mRNA in prokaryotes and Kozak box in eukaryotes.

Although catalysis of the peptide bond involves the C2 hydroxyl of RNA's P-site adenosine in a proton shuttle mechanism, other steps in protein synthesis (such as translocation) are caused by changes in protein conformations. Since their catalytic core is made of RNA, ribosomes are classified as "ribozymes,"[42] and it is thought that they might be remnants of the RNA world.

Addition of translation-independent amino acids

Presence of a ribosome quality control protein Rqc2 is associated with mRNA-independent protein elongation.[49][50] This elongation is a result of ribosomal addition (via tRNAs brought by Rqc2) of CAT tails: ribosomes extend the C-terminus of a stalled protein with random, translation-independent sequences of alanines and threonines.[51][52]

Origin

The ribosome may have first originated in an RNA world, appearing as a self-replicating complex that only later evolved the ability to synthesize proteins when amino acids began to appear.[54] Studies suggest that ancient ribosomes constructed solely of rRNA could have developed the ability to synthesize peptide bonds.[55][56][57]

In addition, evidence strongly points to ancient ribosomes as self-replicating complexes, where the rRNA in the ribosomes had informational, structural, and catalytic purposes because it could have coded for tRNAs and proteins needed for ribosomal self-replication.[58] Hypothetical cellular organisms with self-replicating RNA but without DNA are called ribocytes (or ribocells).[59][60]

As amino acids gradually appeared in the RNA world under prebiotic conditions,[61][62] their interactions with catalytic RNA would increase both the range and efficiency of function of catalytic RNA molecules.[54]

Thus, the driving force for the evolution of the ribosome from an ancient self-replicating machine into its current form as a translational machine may have been the selective pressure to incorporate proteins into the ribosome’s self-replicating mechanisms, so as to increase its capacity for self-replication.



Asterix 30.06.2019 17:01
продолжаем наше предварительное исследование рибосомного вопроса..

IRES sequences were first discovered in 1988 in the poliovirus (PV) and encephalomyocarditis virus (EMCV) RNA genomes in the labs of Nahum Sonenberg[1] and Eckard Wimmer,[2] respectively.

They are described as distinct regions of RNA molecules that are able to recruit the eukaryotic ribosome to the mRNA. This process is also known as cap-independent translation.

It has been shown that IRES elements have a distinct secondary or even tertiary structure, but similar structural features at the levels of either primary or secondary structure that are common to all IRES segments have not been reported to date.

In recent years it has become common for molecular biologists to insert IRES sequences into their vectors to allow for expression of two genes from a single vector—for example, a transgene and a fluorescent reporter molecule. The first gene is initiated at the normal 5' cap, and the second gene is initiated at the IRES.[3]

Location

IRESs are commonly located in the 5'UTR of RNA viruses and allow translation of the RNAs in a cap-independent manner.
However, mRNAs of viruses from Dicistroviridae family possess two open reading frames (ORFs), and translation of each is directed by two distinct IRESs.
It has also been suggested that some mammalian cellular mRNAs also have IRESs.
These cellular IRES elements are thought to be located in eukaryotic mRNAs encoding genes involved in stress survival, and other processes critical to survival.
As of September 2009, there are 60 animal and 8 plant viruses reported to contain IRES elements and 115 mRNA sequences containing them as well.[4]

Activation

IRESs are often used by viruses as a means to ensure that viral translation is active when host translation is inhibited. These mechanisms of host translation inhibition are varied, and can be initiated by both virus and host, depending on the type of virus.

However, in the case of most picornaviruses, such as poliovirus, this is accomplished by viral proteolytic cleavage of eIF4G so that it cannot interact with the 5'cap binding protein eIF4E. Interaction between these two eukaryotic initiation factors (eIFs) of the eIF4F complex is necessary for 40S ribosomal subunit recruitment to the 5' end of mRNAs, which is further thought to occur with mRNA 5'cap to 3' poly(A) tail loop formation. The virus may even use partially-cleaved eIF4G to aid in initiation of IRES-mediated translation.

Cells may also use IRESs to increase translation of certain proteins during mitosis and programmed cell death. In mitosis, the cell dephosphorylates eIF4E so that it has little affinity for the 5'cap. As a result, the 40S ribosomal subunit , and the translational machinery is diverted to IRES within the mRNA.
Many proteins involved in mitosis are encoded by IRES mRNA. In programmed cell death, cleavage of eIF-4G, such as performed by viruses, decreases translation. Lack of essential proteins contributes to the death of the cell, as does translation of IRES mRNA sequences coding proteins involved in controlling cell death.[5]

Mechanism

To date, the mechanism of viral IRES function is better characterized than the mechanism of cellular IRES function,[6] which is still a matter of debate. HCV-like IRESs directly bind the 40S ribosomal subunit to position their initiator codons are located in ribosomal P-site without mRNA scanning. These IRESs still use the eukaryotic initiation factors (eIFs) eIF2, eIF3, eIF5, and eIF5B, but do not require the factors eIF1, eIF1A, and the eIF4F complex. In contrast, picornavirus IRESs do not bind the 40S subunit directly, but are recruited instead through the eIF4G-binding site.[7] Many viral IRES (and cellular IRES) require additional proteins to mediate their function, known as IRES trans-acting factors (ITAFs). The role of ITAFs in IRES function is still under investigation.
Testing

Testing a particular RNA sequence for IRES activity relies on a bicistronic reporter construct.
When an IRES segment is located between two reporter open reading frames in a eukaryotic mRNA molecule (a bicistronic mRNA), it can drive translation of the downstream protein coding region independently of the 5'-cap structure bound to the 5' end of the mRNA molecule.

In such a setup,both proteins are produced in the cell. The first reporter protein located in the first cistron is synthesized by the cap-dependent initiation, while translation initiation of the second protein is directed by the IRES element located in the intercistronic spacer between the two reporter protein coding regions.

However, there are several caveats to be aware of when interpreting data produced using bicistronic reporter constructs.[8] For example, there are several known cases of mis-reported IRES elements that were later recognized as promoter-containing regions. More recently, splice acceptor sites within several presumed IRES segments have been shown to be responsible for apparent IRES function in bicistronic reporter assays.[9]

Limitations and alternatives

IRES sequences are often used in molecular biology to mimic a polycistronic mRNA. You can put several genes on one plasmid and just need one promotor and terminator. The advantage of this technique is that molecular handling is improved. The problem about IRES is that the expression for each gene is decreased. [10]

Another viral element to establish polycistronic mRNA in eukaryotes are 2A-peptides. [11] Here the gene expression does not decrease.



Рекрут 30.06.2019 17:06
Ас: Только без квантовых фантомов и спинтронного излучения. Мы сделаем все просто как все остальные учэные молбиологи делают.

ПГ: Покажите, где и как я говорил, что ДНК фантомы и спинтронное излучение генома играет какую-то роль в поставленной проблеме? Нет, ПОКА только чисто лингвистические аспекты игры смыслов сиом кодонов, зависимых от контекстов мРНК. Не подкидывайте мне то, что не говорил. Это не прилично.



Asterix 30.06.2019 17:16
и немного для себя вот нашел , интересненько так ... хотя китайцы эти ... не люблю [Scientific Reports] мусорный журналчик . Но сама тема вполне здравая ... может даже попробую себе 2А этот вставить в гибридный белочек ... удобно однако

[The 2A self-cleaving peptide (2A), which was discovered in the foot-and-mouth-disease virus (FMDV) in 1991, is an oligopeptide (usually 19–22 amino acids) located between two proteins in some members of the picornavirus family3.
The 2A self-cleaving peptide of FMDV might undergo self-cleavage to generate mature viral proteins by a translational effect that is known as “stop-go” or “stop-carry”. The cleavage site is located between the last glycine of its C-terminal and the first praline of the 2B downstream protein (−LLNFDLLKLAGDVESNPG↓P-)4,5 (Fig. 1A).

To date, 2A-like sequences in other viral mRNA molecules have been successfully identified, including the porcine teschovirus-1 2A (P2A), thosea asigna virus 2A (T2A), equine rhinitis A virus 2A (E2A), cytoplasmic polyhedrosis virus (BmCPV 2A), and flacherie virus (BmIFV 2A) of B. mori6,7. The MGES based on 2As has the following advantages:
(i) multiple proteins known to be expressed in equivocal amounts in the same cells and tissues because they were controlled by only one promoter,
(ii) 2A is small, which can readily cleave multiple proteins while minimizing the possibility of their loss of function, and
(iii) proteins linked by 2A could be co-expressed in all cell types because cleavage activity was only dependent on the ribosome, which is highly structurally conserved in eukaryotes8.
Thus, MGES based on 2A sequences have been widely applied in gene therapy to treat cancer and other diseases6,9,10, and to genetically modify organisms to create new functional or resistant plants and animals11,12.
Furthermore, many researchers have used 2A sequences to study the function of genes in mice13, zebrafish14, swine15, fruit fly16, and sheep species17.]



Asterix 30.06.2019 17:23
Петрович, вы изучайте материалы ... нам еще эксперимент писать, Про фантомы - это я так к слову ... чтоб понятно об чем речь , без эзотерики вообщем.


Главный читатель и он же писатель в клетке - это рибосома .. Она читает РНК и пишет белки.

Очень важно разобраться сначала в механизме ее работы, как она читает и как пишет и потом уже смотреть как нам поставить эксперимент с Единым Универсальным Кодоном, который бы ясно указывал на его бытие в рибосомном мире текстов и смыслов.



Рекрут 30.06.2019 22:21
(Asterix @ 30.06.2019 18:23)
Ссылка на исходное сообщение  Петрович, вы изучайте материалы ... нам еще эксперимент писать,  Про фантомы - это я так к слову ... чтоб понятно об чем речь , без эзотерики вообщем.
Главный читатель  и он же писатель в клетке  - это рибосома .. Она читает РНК  и пишет  белки.

Очень важно разобраться сначала в механизме ее работы, как она читает и как пишет  и потом уже смотреть  как нам поставить эксперимент  с Единым Универсальным Кодоном, который бы ясно указывал  на его бытие  в рибосомном мире  текстов и смыслов.

Так единого и универсального кодона может и не быть. Объяснил почему. Возражений не последовало. Он вполне может быть одним из 32 сиом кодоноа, каждый из которых способен к перекодировкам на все 20 аминокислот, включая Стоп-сиомы. Где логические (пока) возражения?



Asterix 30.06.2019 22:30
Да какие тут возражения , помилуйте ,

Нам надо показать универсальность Одного Кодона , потом второго и потом третьего .. а далее по индукции - они все универсальны.. Это теорема очень старая , еще с Эвйлидовских времен существует.

Что собственно и имеет ввиду ваша теория Волнового Принципа в Генетике ... Информация тонко размазана по всей системе и ее невозможно понять в принципе , будь мы даже 9-то пядей во лбу.



Рекрут 30.06.2019 22:37
Ас: и немного для себя вот нашел , интересненько так ... хотя китайцы эти ... не люблю [Scientific Reports] мусорный журналчик . Но сама тема вполне здравая ... может даже попробую себе 2А этот вставить в гибридный белочек ... удобно однако

ПГ: Ссылку на эту статью не мешало бы иметь...



Рекрут 30.06.2019 22:50
Ас: Что собственно и имеет ввиду ваша теория Волнового Принципа в Генетике ... Информация тонко размазана по всей системе и ее невозможно понять в принципе , будь мы даже 9-то пядей во лбу.

ПГ: "тонко размазанность" в биосистеме может иметь три варианта - 1. квантовая нелокальность всего метаболома, 2. голографическая нелокальность генетической информации, 3. текстовая нелокальность, когда геном биосистемы конструирует некие общие положения, распространяемые на все уровни организации биосистем. Но теор база этих положений не разработана. Это слабость теоретической генетики. Так что до экспериментов пока далековато.



Asterix 30.06.2019 22:58
Ну вот как , пришли к нулю .. как в том стишке про Человек Рассеянный с Улицы Бассейной .. Еду я вторые сутки, а приехал я назад, в город Ленинград... теоретическая база не разработана и до эспериментов пока нам далековато...

Вы прям весь мой энтузиазм убили ... не надо так жестко формулировать.

Разрабатывайте тероретическую базу , разрабатывайте ... за экспериментами дело не станет , за мной не заржавеет. Зуб даю.

Нам нужна теория Единого Универсального Кодона . И вы единственный, кто может такую теорию создать.



Рекрут 01.07.2019 14:58
Текстовость генетической информации может отображаться как МЕМ-конструкции (Вспоминаем "Эгоистический ген" Докинса), т.е. привычные повторяющиеся словесные конструкции. К ним можно свести всю огромную кухню малыхРНК, включая тРНК, рибосомную РНК, IRES elements и т.д., коим несть числа. И все они стратегически объединены понятием СМЫСЛОВ, регулирующих биосинтез белков. К ним можно добавить короткие РНК последовательности, играющие роль знаков пункнтуации. Словом бездна. Бездна и возможных экспериментов. Поэтому лучше бы вернуться к первой схеме - с сиомами в лице мет. и не мет. кодонов



Asterix 02.07.2019 01:13
Ну так общие слова-то о бездне смысла в семантическом мире малых РНК никто не опубликует .. Таких философов в сети - пруд пруди ...

Нам нужен конкретный эксперимент по конкретной идее - Доказательство Существования Универсального Кодона в мире живой клетки..



Рекрут 02.07.2019 08:49
(Asterix @ 02.07.2019 02:13)
Ссылка на исходное сообщение  Ну так общие слова-то о бездне смысла в семантическом мире малых РНК  никто не опубликует ..  Таких философов  в сети  - пруд пруди ...

Нам нужен конкретный эксперимент  по конкретной идее  -  Доказательство Существования Универсального  Кодона  в мире  живой клетки..

А мы для себя философствуем, для служебного пользования (ДСП). Чтобы понять хотя бы общую картину генома с позиций новой генетики. Тем более, Вы же ничего возразить против не можете, но все с оглядочкой на дядей, которые решают - публиковать или нет. А если эти дяди в редколлегиях - просто м....и?
Конкретный эксперимент - проверить все 32 сиом кодона, включая метиониновый, на заменяемость нуклеотидов по всем трём позициям. Начинайте.



Рекрут 02.07.2019 11:46
Но начала экспериментов пока не видно, но философствований по поводу их корректности много.



Asterix 02.07.2019 15:06
Ну так я и предлагаю начать , и начать конечно же с первого кодона , с метионинового.

За вами дизайн эксперимента , что и как делать , детализация гипотезы и ее проверки. Необходимо предсказать результаты эксперимента пользуясь Теорией Универсального Кодона , чтобы по результатам можно было сделать вывод о его существовании в природе , а не только в уме теоретиков. .. Вы же знаете теорию струн в физике > там никаких экспериментов невозможно сделать , и она навсегда останется красивой пустышкой.

У нас же есть все необходимые инструменты для экспериментирования на живой клетке, сдерлать 64 праймера и заменить при помощи ПЦР первый Кодон на все 64 варианта совершенно доступное даже биохакеру дело. .. Нужна теория которую можно проверить в практических экспериментах.

Все просто , пишите гипотезу и как именно будем проверять.



Рекрут 02.07.2019 23:24
(Asterix @ 02.07.2019 16:06)
Ссылка на исходное сообщение  Ну так я и предлагаю начать , и начать конечно же с первого кодона , с метионинового.

За вами дизайн эксперимента , что и как делать  , детализация  гипотезы  и ее проверки. Необходимо предсказать  результаты эксперимента  пользуясь  Теорией Универсального Кодона    , чтобы по результатам можно было сделать вывод  о его существовании в природе  , а не только в уме  теоретиков.    .. Вы же знаете теорию  струн в физике > там никаких экспериментов невозможно сделать , и она навсегда останется  красивой пустышкой.

У нас же есть все необходимые инструменты  для экспериментирования на живой клетке, сдерлать  64  праймера  и заменить  при помощи ПЦР первый Кодон  на все 64  варианта  совершенно доступное  даже биохакеру  дело.  .. Нужна теория  которую можно проверить  в практических экспериментах.

Все просто , пишите гипотезу  и как именно будем проверять.

Это далеко не просто. Покушаемся на нечто огромное, неисчерпаемое. Требующее коллективного обсуждения, что было бы полезно. Молбиологи, включайтесь. Моя гипотеза мРНК-контекст зависимого делегирования значений смыслов 3'-нуклеотиду сиом кодонов требует глубокого осмысления и развития. Замечу, что не претендую на единоличный приоритет в нарождающейся теории. Участвуют все. Это же и поможет грамотно поставить эксперименты.



Asterix 03.07.2019 01:25
Ну таки хоть на начните же дискуссию .. предложите эксперимент-то?

Что толку молиться на непознаваемость ГенКода, Покушаемся на нечто Огромное, Неисчерпаемое, а давайте его раздраконим , А? ПО-нашему , по научному ... Выясним как он устроен на самом деле . .. Давайте его и исчерпаем и ограничим.



Asterix 03.07.2019 01:47
вот вам Петрович еще в помощь к теории Единого Кодона ... недавняя публикация кстати.

Липиды могут специфически связываться с нуклеиновыми кислотами, образуя в геномной ДНК
кодовую последовательность и участвуя в реализации языка генома. Методом молекулярной
динамики изучено взаимодействие олигонуклеотида ДНК (дА)20·(Т)20 с
фосфатидилэтаноламином.
Комплекс получен в ходе молекулярного докинга, и липид
располагается в малой бороздке ДНК, энергия связывания комплекса равна 6,3 ккал/моль.
Показано образование водородных связей, взаимодействий, предшествующих подобным связям, и
ряда других взаимодействий между фосфолипидом и ДНК.
В ходе молекулярной динамики
количество подобных взаимодействий колеблется от 175 до 337. Основную роль в стабилизации
комплекса ДНК-фосфолипид, наряду с водородными связями, играют ван-дер-ваальсовы и
гидрофобные взаимодействия.
Показана роль этаноламинной группы на комплексообразование
фосфолипида с ДНК.

К проблеме липидного кодирования геномной ДНК: особенности молекулярной динамики комплексов ДНК с фосфолипидом Текст научной статьи по специальности «Биология»

Жданов Р.И. Аюпов Р.Х. Андрианов Г.В. Акберова Н.И. Ибрагимова М.Я.



КиберЛенинка: https://cyberleninka.ru/article/n/k-problem...-s-fosfolipidom ( https://cyberleninka.ru/article/n/k-probleme-lipidnogo-kodirovaniya-genomnoy-dnk-osobennosti-molekulyarnoy-dinamiki-kompleksov-dnk-s-fosfolipidom )



Рекрут 03.07.2019 08:51
Ссылку дали не на статью Р.И.Жданова и др.

Ренада Ибрагимовича Жданова знаю лично, был на его выступлении и сам выступал у них в Казанском университете. Идея его интересная, но насколько знаю, пока никто независимо не работал в этом направлении. Поэтому включать еще и это в сферу наших идей и методов несколько преждевременно.

Но поскольку Вы рветесь в бой, повторяю в который раз - воспроизведите, с Вашими поправками, ранние работы по замене 1-го, 2-го и 3-го нуклеотидов в сиом кодоне метионина. А для контроля на уникальность Мет-кодона, сделайте такие же замены в одном из 31 оставшихся сиом-кодонов. Это уже немалая и существенная работа. За это время было бы неплохо обсудить с мол биологами мою гипотезу мРНК-контекст зависимого делегирования значений смыслов 3'-нуклеотиду сиом кодонов. Пока же она явно недопонимается - идет массовое скачивание их, но цитирований нет https://www.scirp.org/journal/PaperInformat...x?PaperID=57601 ( https://www.scirp.org/journal/PaperInformation.aspx?PaperID=57601 ) и https://www.scirp.org/journal/PaperInformat...x?PaperID=85202 ( https://www.scirp.org/journal/PaperInformation.aspx?PaperID=85202 )



Asterix 03.07.2019 12:51
Что значит воспроизведите ранние работы? У нас должна быть своя уникальная работа. Вы же и сам прекрасно знаете что в научных публикациях результаты очень плоховоспроизводимы , но отрицательные результаты никто не публикует .

Нам нужны новые эксперименты и новые результаты , круче прежних.

Вот идея Единого Универсального Кодона - это уже передний край в современной науке , крутизна я вам скажу весьма существенная.

Общие слова не рабояют , нужна деталировка , что именно будем делать с метионином и как его проверять на Универсальную Уникальность? И какой именно другой кодон будем брать в качестве контроля . Нам же нужем и контроль и на неуниверсальность тоже .

Это сначит возьмите один из 31 сиом кодонов? ... Какой именно взять и почему именно его и в каком контексте его проверять и как это экспериментально оформить? Что именно смотреть и каким методом?



Рекрут 03.07.2019 16:40
(Asterix @ 03.07.2019 13:51)
Ссылка на исходное сообщение  Что  значит  воспроизведите ранние работы?  У нас должна быть  своя уникальная работа. Вы же и сам прекрасно знаете  что в научных публикациях  результаты  очень плоховоспроизводимы , но отрицательные результаты  никто  не публикует .

ПГ: это все понятно.

Нам нужны новые эксперименты  и новые результаты ,  круче прежних.

ПГ: согласен.

Вот  идея Единого Универсального  Кодона - это  уже передний край  в современной науке  , крутизна я вам скажу  весьма существенная.

ПГ: красиво, но...

Общие слова не  рабояют , нужна деталировка , что именно будем делать с  метионином  и как его  проверять  на Универсальную Уникальность?  И какой именно другой кодон будем брать  в качестве контроля .  Нам же нужем и контроль и на неуниверсальность  тоже .

ПГ: Нужен

Это сначит возьмите один  из  31  сиом кодонов? ... Какой именно взять  и почему именно его    и в каком контексте  его проверять  и как это экспериментально оформить?  Что именно смотреть  и каким методом?

ПГ: лучше найти простые теор-методические подходы. Думаю.








Рекрут 04.07.2019 09:25
Сиом----синонимические виртуальные перекодировки по кодирующим дублетам генетического белкового кода
Внимательный анализ стандартной таблицы генетического кода дает, в частности, такие наблюдения.
Семейство Син кодонов TCT TCC TCA TCG кодирует Серин
Два триплета Сиом кодонов AGT AGC тоже кодируют Серин
То есть имеет место, вероятно, виртуальная трансформация кодирующих дублетов
AG--->TC, дающая возможность Сиом дублету AG кодировать Серин по Синонимическому пути.
-------------
Семейство Син кодонов CGT CGC CGA CGG кодирует Аргинин
Два триплета Сиом кодонов AGA AGG тоже кодируют Аринин
То есть имеет место, вероятно, виртуальная трансформация кодирующих дублетов
AG--->CG, дающая возможность Сиом дублету AG кодировать Аргинин по Синонимическому пути.
-------------
Семейство Син кодонов CTT CTC CAA CTG кодирует Лейцин
Два триплета Сиом кодонов TTA TTG тоже кодируют Лейцин
То есть имеет место, вероятно, виртуальная трансформация кодирующих дублетов
TT--->CT, дающая возможность Сиом дублету TT кодировать Лейцин по Синонимическому пути.
-------------
Из этих наблюдений следует предположение, что по аналогии такой путь Сиом----синонимических виртуальных перекодировок происходит по всем кодирующим Сиом-Синонимическим дублетам генетического белкового кода. Это не означает, что имеет место кодоновый семантический хаос в таком векторе работы генома. Наоборот, это дает широчайшие возможности генетическому коду адаптироваться к окружающей переменчивой среде.



Asterix 04.07.2019 11:05
Ну чтож , наблюдение над таблицей генэтического кода довольно интересное. Но ведь возможны и другие обьяснения , не менее глубокие и оригинальные.

Но как же нам экспериментально показать , пользуясь научным методом , что эта идея действительно работает в реальности? А не являетсяа фантомом человеческого сознания?

какие можно поставить эксперименты чтобы это выяснить и раскрыть механизм как оно все происходит на уровне рибосомы?

Классическая теория Ген Кода утверждает что в клетке существует 64 разных тРНК и у каждой есть свой уникальный антикодон который входит во взаимодействие с кодоном на мРНК что собственно и обеспечивает воспроизводимость белкового синтеза. Соотвествие кодон-антикодон однозначное и исключения только подтверждают это правило.

Сиом-Гипотеза Ген Кода предсказывает что все на самом деле не так и некоторые Кодоны универсальны по природе своей и могут кодировать любую аминокислоту. Рибосома способна считывать нужное значение такого нуль-кодона из контекста мРНК , которая в данной трактовке рассматривается как фраза на человеческом языке. а рибосома - это разум читающий эту фразу и знающий ее контекст.

И точно так же как одна и та же фраза содержащая понимо обычных букв еще и универсальные буквенные символы может быть прочитана совершенно по разному.

Как это на практике? Ну начнем с человеческой фразы с Универсальной Буквой

Скажем ^ пусть означает один из гласных звуков А О У Е И.

Имеем пентаграмматон Г^Р^М , который может принимать значения гарем , горем , гурем, гуран, гирун, герон, горим, итд ... Человек читая фразу из текста сказок 1001 Ночи совершенно безошибочно прочет этот пентаграмматон как ГАРЕМ, в тексте про фармакомпании он прочтет это как ГЕРОН, ну а в тексте про пожарников как ГОРИМ. Эти слова совершенно разные по смыслу.

Таким образом одно и то же слово включающее в себя универсальную букву может быть прочитано множественным образом .

кка перевести эту же ситуацию на уровень рибосомы читающей мРНК в клетке? Ну очевидно что если рибосома умееет читать контекст то она может делать несколько разных аминокислот в одной и той же позиции в зависимости от того какой это предполагается из контекста будет белок.

Ну минимальная ситуация такого гипотетического контекстного кодирования это как раз кодон метионин.. Его смысл не зависит от содержания вообще никак . Рибосома обязана начинать белковую фразу с метионина так же как мы распознаем начало предложения по заглавной букве.
А вот далее по тексту возможны варианты и всякая там отсебятина , ну как и у людей . .. Но когда дело доходит до аминокислоты значимой для каталитической активности белка, то опять вступает в действие знание рибосомой контекста данной мРНК и она железно вставит нунужную аминокислоту невзирая на последовательность нуклеотидов в кодоне находящемся в данной позиции.

Вот редактируйте меня Петрович. Может я чего неправильно понял?

Ну а далее нам надо перевести эту гипотезу в простой изящный научный эксперимент который ее либо подтвердит либо опровергнет.

какие будут соображения по поводу такого экперимента?



Рекрут 04.07.2019 13:41
(Asterix @ 04.07.2019 12:05)
Ссылка на исходное сообщение  Ну чтож , наблюдение над таблицей генэтического  кода  довольно интересное. Но ведь возможны и другие обьяснения , не менее глубокие  и оригинальные.

ПГ: ну так дайте его, глубокое и оригинальное.smile.gif

Ас: Но как же нам экспериментально  показать , пользуясь научным методом ,  что эта идея действительно работает  в реальности?  А не являетсяа фантомом человеческого сознания?

ПГ: Идея основана на экспериментам по табличной шифровке синтеза белков.

Ас: какие можно поставить эксперименты  чтобы это выяснить  и раскрыть механизм  как оно все происходит  на уровне рибосомы?

ПГ: Уже опубликованного, независимо от меня и моих работ, достаточно, чтобы сделать первые и правильные шаги а новой генетике.

Ас: Классическая теория  Ген Кода  утверждает  что в клетке существует  64  разных  тРНК  и у каждой  есть  свой уникальный антикодон  который входит во взаимодействие с кодоном на  мРНК  что собственно и обеспечивает  воспроизводимость белкового синтеза. Соотвествие  кодон-антикодон однозначное  и исключения  только подтверждают  это  правило.

ПГ: Вот тут-то и ошибаетесь.

тРНК генов. В хромосоме E. coli имеется 86 тРНК-генов. Многие гены тРНК являются избыточными. Гены тРНК, которые являются избыточными, хорошо коррелируют с тРНК, которые наиболее многочисленны в клетке (тРНК, которые распознают наиболее часто используемые кодоны) и однократными тРНК, кодируют менее обильные тРНК (т.е. тРНК, которые распознают редко используемые кодоны). http://www.sci.sdsu.edu/~smaloy/MicrobialG...sup/wobble.html ( http://www.sci.sdsu.edu/~smaloy/MicrobialGenetics/topics/rev-sup/wobble.html )

Число генов, кодирующих тРНК для одной и той же аминокислоты, может различаться у разных организмов более чем на порядок. Общее число генов тРНК в различных  организмах сильно варьирует (напр., у кишечной палочки Escherichia coli их ок. 70, у шпорцевой лягушки Xenopus laevis ок. 7 тыс., у человека св. 1 тыс.). http://www.xumuk.ru/encyklopedia/2/4540.html ( http://www.xumuk.ru/encyklopedia/2/4540.html )


Ас: Сиом-Гипотеза  Ген Кода  предсказывает  что все на самом деле не так и  некоторые  Кодоны  универсальны  по природе  своей  и могут кодировать любую аминокислоту. Рибосома  способна считывать нужное значение  такого нуль-кодона  из контекста  мРНК , которая в данной трактовке рассматривается как фраза  на человеческом языке.  а рибосома - это разум читающий эту  фразу  и знающий ее контекст.
И точно так же как одна и та же фраза содержащая помимо обычных букв еще и  универсальные буквенные символы  может быть прочитана совершенно по разному.

Как это на практике?  Ну начнем с человеческой фразы с Универсальной Буквой

Скажем  ^  пусть означает  один из гласных звуков  А О У Е И.

Имеем  пентаграмматон  Г^Р^М  , который может принимать  значения    гарем , горем , гурем, гуран, гирун,  герон, горим,  итд  ...  Человек  читая фразу  из текста сказок  1001  Ночи  совершенно безошибочно прочет этот пентаграмматон как ГАРЕМ, в тексте  про фармакомпании  он  прочтет это как  ГЕРОН,  ну а в тексте про пожарников    как  ГОРИМ.  Эти слова совершенно разные  по смыслу.

  Таким образом одно и то же слово  включающее в себя универсальную букву  может быть прочитано  множественным образом .

квк перевести  эту же ситуацию на уровень  рибосомы  читающей  мРНК  в клетке?  Ну очевидно  что если рибосома умееет читать контекст  то она может делать  несколько разных аминокислот  в одной и той же позиции  в зависимости от того какой это предполагается из контекста будет  белок.

Ну минимальная ситуация  такого  гипотетического контекстного  кодирования  это как раз кодон метионин..  Его  смысл  не зависит от содержания вообще никак . Рибосома обязана начинать белковую фразу  с метионина  так же как мы распознаем начало предложения по заглавной букве.
А вот далее по тексту  возможны варианты  и всякая там отсебятина , ну как и у людей . .. Но когда дело доходит  до аминокислоты  значимой для каталитической активности  белка, то опять вступает в действие знание рибосомой контекста данной мРНК  и она железно вставит  нужную аминокислоту  невзирая  на последовательность  нуклеотидов  в кодоне находящемся в данной позиции.

Вот редактируйте  меня Петрович.  Может я чего неправильно понял?

Ну а далее нам надо перевести  эту гипотезу  в простой  изящный  научный эксперимент  который ее либо подтвердит  либо опровергнет.

какие будут соображения  по поводу такого  эксперимента?

ПГ: Как Вы, должно быть, уже поняли, я не являюсь экспертом в Вашей области и подхожу к ней как  теоретик, что тоже дает практические результаты (см. наши публикации). Но не в области чисто прикладных методик работы с биосинтезом белков и их генами. Но скажу, что Ваш  "пентаграмматон  Г^Р^М"  очень глубок. И он в целом подтверждает мРНК контекстные влияния на биосинтез белков и виртуальные корректирующие замены её нуклеотидов. Вы сделали утверждающий кивок в сторону моих положений, которые излагал тут. И тоже стали на пару минут теоретиком. С чем и поздравляю. 
Добавлю только, что метионин вряд-ли заглавная буква, он обратный по смыслу Стоп кодону. Оба несут НЕ ТЕКСТОВУЮ функцию, но механическую - начать и закончить синтез белка. Все остальные первые буквы кодонов связаны с текстовым содержанием мРНК и их продуктами - белками.  Весь семантически запутанный (но не хаотический) ареал смыслов мРНК-белкИ очень трудно поддается планированию в экспериментальном отношении. Но можно поискать ответы в базах данных по сиквенсу мРНК и синтезируемых на них белков. То, что предлагал в начале наших обсуждений. Там могут и должны быть, по крайней мере, нарушения коллинеарностей. Это б ыло бы уже хорошей добычей. Но как подобраться к перекодировкам кодирующих сиом дублетов, ведь они же при этом превращаются (входят в состав) син кодонов...  Может быть удастся как-то узнать их сиом-предысторию... Тут мозги уже слегка закипают. smile.gif
Кстати, кажущийся избыток тРНК в биосистемах может быть связан с обилием перекодировок сиом и возникновением новых син кодонов, которые надо обслуживать? целой армией тРНК?





Asterix 04.07.2019 20:33
---я не являюсь экспертом в Вашей области и подхожу к ней как теоретик..----

Ну уже что-то ... А давайте рассмотрим даже не метионин, а триптофан?

Какие будут соображения по поводу его кодона ? Ведь это очень частый элемент в центре катализа ферментов.
Не будет ли Триптофан таким супер-кандидатон на роль Единого Универсального Кодона который определяется рибосомой не по буквальному смыслу его триплета, а по контексту белковой мРНК.



Рекрут 04.07.2019 21:13
(Asterix @ 04.07.2019 21:33)
Ссылка на исходное сообщение  ---я не являюсь экспертом в Вашей области и подхожу к ней как  теоретик..----

Ну уже что-то ... А давайте рассмотрим даже не метионин,  а триптофан?

Какие будут соображения по поводу его  кодона ?  Ведь это  очень частый элемент  в центре катализа  ферментов.
  Не будет ли  Триптофан таким супер-кандидатон  на роль  Единого Универсального Кодона  который определяется рибосомой не по буквальному  смыслу  его триплета,  а по контексту  белковой  мРНК.

Отчего же, давайте облюбуем сиом триптофана. Поменяем в сиоме все 3 буквы.Триптофан в син кодонах не фигурирует. Поменяем в его сиоме 2-ю букву G на C. Должны получить син кодон СЕРИНА. Это тем более интересно, что сиом TGA, рассматриваемого семейства TG, шифрует СТОП.



Asterix 05.07.2019 02:04
А давайте не побоимся отвестсвенности перед мировым сообществом молбиологов и замахнемся на старинный ГенКод.. В начале он был однобуквенный что очевидно из таблицы генкода

Вот какие 4 аминокислоты по вашему разумению могли бы быть самыми первыми в коде? Когда он был однобуквенным еще?



Рекрут 05.07.2019 07:56
(Asterix @ 05.07.2019 03:04)
Ссылка на исходное сообщение  А давайте не побоимся отвестсвенности перед мировым сообществом молбиологов и замахнемся  на  старинный ГенКод.. В начале он был однобуквенный что очевидно из таблицы  генкода

Вот какие  4 аминокислоты  по вашему разумению  могли бы быть самыми первыми  в коде?  Когда он был однобуквенным  еще?

Скорее, двухбуквенным. Идея нашего физика Гамова. Да и сейчас код сохраняет черты двухбуквенного - кодируют дублеты, первые два нуклеотида в син кодонах. Третий вобулирует, обеспечивая выход кода на тексто-ментальные горизонты через сиом кодоны.



Asterix 05.07.2019 13:08
Ну навряд ли он так сразу стал двухбуквеннымн .. Было наверное и время однобуквенности у него в эволюции.

Я вот рассматривая таблицу ГенКода обратил давеча внимание на сектор который начинается с У.. очень особый сектор кода.

По идее в нем есть все необходимые аминикислоты для минимального и очень гидрофобного белка способного к полимеризации в мультибелковые структуры за счет цистеина .. Причем именно в этом секторе сосредоточены все ароматические аминокислоты которые удивительно напомнили мне пурины и пиримидины. Ну сами посмотрите [Trp] - это же вылитый пурин а [Tyr] с [PHE] - это же дико похоже на пиримидины. Ну и лейцин с серином тут же без них белковую цепь особо не построишь..

Странно что на эту особенность Koда никто до сих пор не обрратил внимания.

Какие будут соображения? Отчего это так?



Рекрут 05.07.2019 20:25
(Asterix @ 05.07.2019 14:08)
Ссылка на исходное сообщение  Ну навряд ли он так сразу стал двухбуквеннымн ..  Было наверное и время однобуквенности у него  в эволюции.

ПГ: Типа, например, А кодирует Т(У), Г кодирует Ц и наоборот. В Уотсон-Криковских парах. Или Натрий "кодирует" Хлор в электролите. Но это не кодирование, но чистая физхимия водородных и ионных связей. Кодирование - это всегда знаковые взаимодействия Объекта и его обозначения, Знак ---- Обозначаемое, взаимное  отображение. При сохранении тех же водородных связей, к примеру, в Уотсон-Криковских парных взаимодействиях. 

Я вот  рассматривая таблицу ГенКода  обратил давеча внимание  на сектор  который начинается  с  У..  очень особый сектор  кода.

По идее в нем есть  все необходимые  аминикислоты  для минимального  и  очень гидрофобного  белка  способного  к полимеризации в мультибелковые  структуры  за счет  цистеина ..  Причем  именно в этом секторе  сосредоточены  все  ароматические аминокислоты  которые удивительно напомнили мне  пурины и пиримидины.  Ну сами посмотрите      [Trp] - это же вылитый пурин  а [Tyr] с [PHE] -  это  же  дико похоже на пиримидины. Ну и лейцин с серином  тут же  без них  белковую цепь особо не построишь..

ПГ: Это сектор - 4 семейства (TC TG TT TA), каждое из 4-х кодонов. TG TT TA семейства  - сиомы. Похожесть структуры аминокислот на пурины и пиримидины - этого еще мало для функциональности.

Странно что на эту особенность Koда  никто до сих пор не обрратил внимания. 

Какие будут  соображения?  Отчего это так?




Asterix 06.07.2019 00:48
вот ... Кодирование - это всегда знаковые взаимодействия Объекта и его обозначения, Знак ---- Обозначаемое, взаимное отображение. При сохранении тех же водородных связей, к примеру, в Уотсон-Криковских парных взаимодействиях. ..

А как это транслируется в лигвистике? У вас есть красивые примеры подобных трансляций в языке , Знак-Обьект



Рекрут 06.07.2019 09:17
Любое не искаженное слово есть код, знаковое семантическое отображение предмета, объекта вещественного или ментального. То же в ДНК - РНК - Белковых текстах. Нормальные сдвиги рамок считывания на мРНК создают новые генетические слова и тексты. Перекодировки - тоже.



Рекрут 06.07.2019 09:25
Прыжки рибосом по мРНК, также как и прыжки мобильных генов или даже геномов (ретровирусы) в норме есть помещение их в новые контексты, смысловые ареалы. Не в норме - это запуск патологических состояний, болезней, что в медицине пока terra incognita.



Рекрут 07.07.2019 11:23
Asterix,

давайте попробуем хотя бы это:

Давайте облюбуем сиом триптофана. Поменяем в сиоме все 3 буквы.Триптофан в син кодонах не фигурирует. Поменяем в его сиоме 2-ю букву G на C. Должны получить син кодон СЕРИНА. Это тем более интересно, что сиом TGA, рассматриваемого семейства TG, шифрует СТОП. То есть мы попытаемся повторить искусственно в малом масштабе то, что делает сама Природа Кода. Это будет, в случае успеха, первый шаг в направлении доказательства, что все сиомы потенциально могут кодировать Все аминокислоты, включая недоступные, кодируемые син кодонами (судя по таблице), кроме нескольких. Это будет означать, что для кодонов нет запретов для тотального кодирования. Единственное, что ими управляет в виртуальных перекодировках - это смыслы (контексты) мРНК.

Напомню теор. базу для такого эксперимента:

Сиом----синонимические виртуальные перекодировки по кодирующим дублетам генетического белкового кода
Внимательный анализ стандартной таблицы генетического кода дает, в частности, такие наблюдения.
Семейство Син кодонов TCT TCC TCA TCG кодирует Серин
Два триплета Сиом кодонов AGT AGC тоже кодируют Серин
То есть имеет место, вероятно, виртуальная трансформация кодирующих дублетов AGTC, дающая возможность Сиом дублету AG кодировать Серин по Синонимическому пути.
-------------
Семейство Син кодонов CGT CGC CGA CGG кодирует Аргинин
Два триплета Сиом кодонов AGA AGG тоже кодируют Аринин
То есть имеет место, вероятно, виртуальная трансформация кодирующих дублетов AGCG, дающая возможность Сиом дублету AG кодировать Аргинин по Синонимическому пути.
-------------
Семейство Син кодонов CTT CTC CAA CTG кодирует Лейцин
Два триплета Сиом кодонов TTA TTG тоже кодируют Лейцин
То есть имеет место, вероятно, виртуальная трансформация кодирующих дублетов TTCT, дающая возможность Сиом дублету TT кодировать Лейцин по Синонимическому пути.
-------------
Из этих наблюдений следует предположение, что по аналогии такой путь Сиом----синонимических виртуальных перекодировок происходит по всем кодирующим Сиом-Синонимическим дублетам генетического белкового кода. Это не означает, что имеет место кодоновый семантический хаос в таком векторе работы генома. Наоборот, это дает широчайшие возможности генетическому коду адаптироваться к окружающей переменчивой среде.



Asterix 07.07.2019 17:29
Ну хорошо вот у нас есть зеленый ГФП у него активный центр формируется из 3 аминокислот тирозина , серина и глицина..

Предлагайте как можно заменить один из этих кодонов так чтоб по классической теории произошла бы замена аминокислоты и потеря функции,
а по СИОМ-теории произойдет перекодировка согласно контексту мРНК , который требует в этом месте совершенно определенную аминокислоту. Иначе , при ее замене на любую другую белок не будет светиться , то есть потеряет функциональность.

Эту замену легко сделать, и получить результат , светится или нет.. Этот эксперимент может доказать именно существование самого феномена такого контекстного управления значением кодона в процессе рибосомной трансляции.

Ну это примерно как если бы человек переводил с одного языка на другой и исправлял бы ошибки в исходнике исходя из контекста фраз. В человеческом мире это совершенно обычное дело, ошибки исправлять по контексту. А вот существует ли подобный феномен в микромире живой клетки , и доступно ли такое редактирование Рибосоме - это все еще малоизученный вопрос.



Рекрут 07.07.2019 19:27
(Asterix @ 07.07.2019 18:29)
Ссылка на исходное сообщение  Ну хорошо  вот у нас есть  зеленый  ГФП  у него активный центр  формируется из  3 аминокислот  тирозина , серина и глицина..

ПГ: все три аминокислоты кодируются сиомами, но одна из них, Серин, кодируется и син кодонами семейства TC, и сиомами - AGT и AGC. Это может создать проблемы. По рамке считывания невозможно понять, о каком серине идет речь и каким кодоном, син или сиом, он избыточно кодируется по этим обоим векторам. 

Если же заменять в сиомах глицина - CAA и CAG хоть по одному нуклеотиду, хоть все три сразу, то контекст мРНК все виртуально вернет на  CAA и CAG. Свечение останется. Тоже будет результат, и не плохой. Двойной. Во-первых докажем, что такие замены виртуально компенсируются с возвратом на псевдо CAA и CAG. Во-вторых будет очень демонстративно - кодоны глицина изменены, но вопреки ожиданию, свечение осталось. Только нужен будет сиквенс рамки, чтобы доказать, что замены нуклеотидов были.

Ас: Предлагайте как можно заменить один  из этих кодонов  так чтоб по классической теории  произошла бы замена аминокислоты  и потеря функции,

ПГ: не произойдет замены аминокислоты, несмотря на замены нуклеотидов. Сработает компенсирующий контекст мРНК. Будут работать виртуальные старые кодоны.

Ас: а по СИОМ-теории  произойдет перекодировка  согласно контексту  мРНК  , который требует  в этом месте совершенно определенную аминокислоту.  Иначе , при ее замене  на любую другую  белок не будет светиться , то есть потеряет  функциональность.

Эту замену  легко сделать,  и получить  результат , светится или нет..    Этот эксперимент  может доказать именно существование  самого  феномена такого контекстного  управления значением  кодона  в процессе  рибосомной трансляции.

Ну это примерно как  если бы человек переводил с одного языка на другой  и исправлял бы ошибки в исходнике  исходя из контекста  фраз.  В человеческом мире  это совершенно обычное дело, ошибки исправлять  по контексту.  А вот существует ли подобный феномен  в  микромире  живой клетки  ,  и доступно ли такое редактирование  Рибосоме  - это все еще  малоизученный вопрос.




Рекрут 07.07.2019 22:38
Этот ген из медузы Эквореи, а ее таблица ген кода есть? Мы же ориентируемся на стандартную по E.coli. А если они различаются как диалекты?



Asterix 07.07.2019 22:49
Это уже сильно переделанный код , это для растений код. И в растениях он прекрасно работает .. то есть контекст в них читается . Рибосома знает что это за белок и какие аминокислоты в нем самые важные..

Вот в этом сила .. она знает что читает

ПГ: не произойдет замены аминокислоты, несмотря на замены нуклеотидов. Сработает компенсирующий контекст мРНК. Будут работать виртуальные старые кодоны.



Рекрут 07.07.2019 23:52
Вот ссылка на множественность ген. кодов с указаниями различий от стандартного. Но эквореи там не нашел https://www.ncbi.nlm.nih.gov/Taxonomy/Utils...ntgc.cgi?mode=t ( https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=t )



Asterix 08.07.2019 04:14
Да причем тут экворея, у меня код переписан для растений.. это растительный код ... по сути арабидиопсис . Он отлично работает в и животных и в растительных и в бактериальных и в грибных клетях... Там две мутации которые улучшают его характеристики в плане длины волны возбуждения и растворимости в цитоплазме.

Ну то есть kод переписан, а контекст остался ... он прекрасно светится , значит рибосома видит контекст.



Asterix 08.07.2019 04:25
Да кстати Тирозин очень легко заменить на стоп кодон .. он рядом там .. и замена имено в третьей позиции будет.

То есть мы пришли таки к решающему эксперименту? Как Рибосома отреагирует на замену тирозина на стоп-кодон.. Поставит на его место очень важный дкя флюоресценции тирозин или таки профукает весь контекст и ничего функционального не сделает. Ну как дура какая , неразумная .



Рекрут 08.07.2019 11:18
(Asterix @ 08.07.2019 05:25)
Ссылка на исходное сообщение  Да кстати Тирозин очень легко заменить на стоп кодон .. он рядом там .. и замена имено в третьей позиции  будет.

То есть мы пришли таки к решающему эксперименту?  Как Рибосома  отреагирует на замену тирозина  на стоп-кодон..  Поставит на его место очень важный  дкя флюоресценции  тирозин или таки  профукает весь контекст  и ничего функционального не сделает.  Ну как дура  какая , неразумная .

Да, этот вариант хороший. В случае успеха этот вариант наглядно покажет, что остановки синтеза Зеленого не произошло, свечение осталось. Но сиквенс полученной новой мРНК, с заменами третьих в сиоме Тирозина, все-таки необходим. Сиквенс покажет наличие замены третьего нуклеотида в сиоме Тирозина, который проигнорирован рибосомой за счет виртуального возврата третьих T и C вместо искусственной замены их на A и G. Если контрольный сиквенс не дать (напр., с мечеными A и G), то может сложиться ложное мнение, что никаких замен не было. Эксперимент вызовет смех.
Будем надеяться на успех.



Asterix 08.07.2019 23:17
Ну нам надо бы сюда еще научных экспертов привлечь .. чтоб подсобили с дизайном эксперимента ... Так чтоб потом комар носа бы не подточил.. А то знаю я эту [Nature].. они так и норовят Россию поприжать



Рекрут 09.07.2019 00:21
(Asterix @ 09.07.2019 00:17)
Ссылка на исходное сообщение  Ну нам надо бы сюда еще научных экспертов привлечь .. чтоб подсобили с дизайном  эксперимента ... Так чтоб потом комар носа бы не подточил..  А то знаю я эту [Nature].. они так и норовят  Россию  поприжать

Абсолютно согласен.



Поклонник Талантов 09.07.2019 16:11
Текстовость триплета 3'-нуклеотиду CGT CGC CGA CGG кодона UGA реснитчатой инфузории может отображаться как МЕМ-кодон (Вспоминаем белкового кода), т.е. привычные повторяющиеся словесные кодоны цистеин и селеноцистеин. К ним можно свести всю огромную кухню малых Серин, включая тСерин, рибосомную Серин, CTT CTC CAA CTG и т.д., Ф.Крик и М.Ниренберг в 1964г., .
И все они стратегически объединены понятием СиомОВ, регулирующих биосинтез белков мРНК. К ним можно добавить короткие Серин последовательности, лейцин кодируется двумя семействами кодонов - CT семейством (кодоны синонимы) и TT семейством (сиом кодоны), играющие роль знаков пункнтуации.
Словом Молбиологи. Бездна и возможных 3'-нуклеотиду . Поэтому лучше бы вернуться к первой схеме - с сиомами в лице мет. и не мет. кодонов 3'-нуклеотиду .
Об триплета и даже высказывал идею на 3'-нуклеотиду , но там специалистов нет, кроме двух мРНК. Но гипотеза мРНК-контекст , и наверно, сыровато. Идея: любой сиом триплет может (контектуально-зависимо) шифровать все 20 аминокислот, включая СТОПы. Потом бросил Лейцин цистеин и селеноцистеин, претендую на единоличный приоритет . Теперь Вы грамотно поставить эксперименты. Дедуктивный посыл белкового кода.
Сиомы, по своей Аргинин, в своих возможностях, функционально полиморфны и, теоретически, с триплета могут перекодировываться кодона UGA реснитчатой инфузории на все грамотно поставить эксперименты, манипулируя семантикой первых, вторых и третьих нуклеотидов, и присваивая (делегируя) им комбинаторику значений букв A,U,G,С в любых вариациях. Если так, то преимущества в духе CGT CGC CGA CGG очевидны.
Простите за Молбиологи(для служебного пользования) триплета . С одной стороны появляется невероятная приспособительная и, пардон снова, "соображательная" гибкость при мощном биосинтезе коротко живущих белков нейронов мРНК, Молбиологи в совокупности реально мыслят. Эта же гибкость и находчивость для иммунных ответов на уровне иммуноглобулинов по схеме графиков Ву-Кэбота.
С другой стороны, сохраняется первородная невинность исходных ДНК белкового кода последовательностей белковых генов, не распространяемая на "лёгкое поведение" мСерин (еще раз прошу извинить ). Тогда термин "универсальный кодон" можно будет заменить на словосочетание "Молбиологи" Ф.Крик и М.Ниренберг в 1964г.
Понимаете, от проблемы сиомии белкового кода не уйти. Сиомия - объективная реальность.

Где настоящие биологи? Жду возражений.



Рекрут 09.07.2019 18:24
(Поклонник Талантов @ 09.07.2019 17:11)
Ссылка на исходное сообщение  Текстовость триплета 3'-нуклеотиду CGT CGC CGA CGG  кодона UGA реснитчатой инфузории может отображаться как МЕМ-кодон (Вспоминаем белкового кода), т.е. привычные повторяющиеся словесные кодоны цистеин и селеноцистеин. К ним можно свести всю огромную кухню малых Серин, включая тСерин, рибосомную Серин, CTT CTC CAA CTG и т.д., Ф.Крик и М.Ниренберг в 1964г., .
И все они стратегически объединены понятием СиомОВ, регулирующих биосинтез белков мРНК. К ним можно добавить короткие Серин последовательности, лейцин кодируется двумя семействами кодонов - CT семейством (кодоны синонимы) и TT семейством (сиом кодоны), играющие роль знаков пункнтуации.
Словом Молбиологи. Бездна и возможных 3'-нуклеотиду . Поэтому лучше бы вернуться к первой схеме - с сиомами в лице мет. и не мет. кодонов 3'-нуклеотиду .
Об триплета и даже высказывал идею на 3'-нуклеотиду , но там специалистов нет, кроме двух мРНК. Но гипотеза мРНК-контекст , и наверно, сыровато. Идея: любой сиом триплет может (контектуально-зависимо) шифровать все 20 аминокислот, включая СТОПы. Потом бросил Лейцин цистеин и селеноцистеин, претендую на единоличный приоритет . Теперь Вы грамотно поставить эксперименты. Дедуктивный посыл белкового кода.
Сиомы, по своей Аргинин, в своих возможностях, функционально полиморфны и, теоретически, с триплета могут перекодировываться кодона UGA реснитчатой инфузории на все грамотно поставить эксперименты, манипулируя семантикой первых, вторых и третьих нуклеотидов, и присваивая (делегируя) им комбинаторику значений букв A,U,G,С в любых вариациях. Если так, то преимущества в духе CGT CGC CGA CGG очевидны.
Простите за Молбиологи(для служебного пользования) триплета . С одной стороны появляется невероятная приспособительная и, пардон снова, "соображательная" гибкость при мощном биосинтезе коротко живущих белков нейронов мРНК, Молбиологи в совокупности реально мыслят. Эта же гибкость и находчивость для иммунных ответов на уровне иммуноглобулинов по схеме графиков Ву-Кэбота.
С другой стороны, сохраняется первородная невинность исходных ДНК белкового кода  последовательностей белковых генов, не распространяемая на "лёгкое поведение" мСерин (еще раз прошу извинить ). Тогда термин "универсальный кодон" можно будет заменить на словосочетание "Молбиологи" Ф.Крик и М.Ниренберг в 1964г.
Понимаете, от проблемы сиомии белкового кода не уйти. Сиомия - объективная реальность.

Где настоящие биологи? Жду возражений.

Скачано с некоторыми ошибками...



Рекрут 09.07.2019 18:26
(Asterix @ 09.07.2019 00:17)
Ссылка на исходное сообщение  Ну нам надо бы сюда еще научных экспертов привлечь .. чтоб подсобили с дизайном  эксперимента ... Так чтоб потом комар носа бы не подточил..  А то знаю я эту [Nature].. они так и норовят  Россию  поприжать

Так что, начинаем эксперимент? Жутко интересно, что получится... Что-то Вы умолкли...



Asterix 09.07.2019 20:14
Да вот все думаю .. , ну если получится - это Статья в Натуре , ну а предположим не получится , тирозин заменили на Стоп он так и читается как стоп-кодон, а не как тирозин.. и белок зеленый не получается ,

Какие будут соображения , отчего у этого эксперимента такой результат не соотвествующий нашим ожиданиям? И может ли такой эксперимент опровергнуть Сиом- теорию Кода? Ну чтоб все было согласно Попперу Карлу, и комар носа бы не подточил бы.

Я сначала пытаюсь понять наших будущих критиков, как они будут реагировать на те или иные данные из експеримента.



Рекрут 09.07.2019 21:01
(Asterix @ 09.07.2019 21:14)
Ссылка на исходное сообщение  Да вот все думаю .. ,    ну если получится - это  Статья в Натуре , ну а  предположим не получится , тирозин  заменили на Стоп он  так и  читается как стоп-кодон,  а не как тирозин.. и белок  зеленый не получается ,

Какие будут соображения , отчего у этого эксперимента такой  результат   не соотвествующий нашим ожиданиям?  И может ли такой эксперимент опровергнуть  Сиом- теорию Кода?  Ну чтоб все было согласно  Попперу  Карлу,  и комар носа бы не подточил  бы.

Я сначала пытаюсь понять наших будущих критиков, как они будут реагировать  на те или иные данные  из експеримента.

Если стоп сработал, то это означает,что белок короче нормы получился. Так? Укорочение будет причиной не свечения? Будет, если укорочение затронуло активный центр зеленого. Прав? И второе. Тирозин будет заменен на стоп как следствие замен третьих у сиом -T и C на третьи сиомов стопов, т.е. на A и G. Ну заменили, а свечения нет. Это означает, что рибосоме по фиг контекст рамки зеленого или всего прочитанного рибосомой. Иначе говоря, в данном варианте эксперимента получим облом версии мРНК контекстных ориентаций рибосомы и, соответственно, отсутствие виртуальных замен третьих в сиомах. Прав? Но не хотелось бы. В любом случае пристелочные эксперименты ставить надо. И любой результат будет информативным. Кстати, как проверять напрямую, были замены нуклеотидов? Секвенировать? Или косвенно по результату? Но виртуальные замены, если они реализуются, будут маскировать замены в смысле - были они или нет.



Asterix 10.07.2019 00:03
ну после ПЦР реакции и клонирования нового фрагмента всегда можно и отсиквенировать продукт.. Чтоб точно знать какие там кодоны учавствуют в молекулярно-биологическом шоу.

Проблема в доказательности эскперимента ... даст ли он нам однозначный ответ на вопрос о контекстном кодировании.. или оставит еще больше сомнений.



Рекрут 10.07.2019 08:18
(Asterix @ 10.07.2019 01:03)
Ссылка на исходное сообщение  ну после ПЦР реакции и клонирования  нового  фрагмента  всегда можно и отсиквенировать продукт..  Чтоб точно знать какие там кодоны  учавствуют  в молекулярно-биологическом шоу.

Проблема  в  доказательности  эскперимента ... даст ли он нам однозначный ответ  на вопрос  о контекстном  кодировании.. или  оставит  еще больше сомнений.

Точно.
Ну так начинайте.



Asterix 10.07.2019 15:29
Семь раз отмерь , один раз отрежь.. а Сбивать молоко в масло как у некоторых лягушей получалось в притчах про кувшин с молоком мне не сильно интересно , сначала бы оценить степень жирности этого молока и шансы на сметану и масло из него. Потом уж барахтаться и лапками шевелить.

Надо бы литературу пошерстить , что-то подобное народ уже делал и неоднократно, интуиция у меня вот.



Рекрут 10.07.2019 16:40
(Asterix @ 10.07.2019 16:29)
Ссылка на исходное сообщение  Семь раз отмерь , один раз отрежь..    а Сбивать  молоко  в масло как у некоторых лягушей  получалось  в притчах  про  кувшин  с молоком  мне  не сильно интересно , сначала бы оценить  степень жирности  этого молока  и шансы  на сметану  и масло  из него.  Потом уж барахтаться и лапками шевелить.

Надо бы литературу пошерстить , что-то подобное народ уже делал и неоднократно, интуиция у меня вот.

Народ безмолвствует. Шерстил с 1984 года, как только обнаружил квантовые эквиваленты ДНК, предсказанные А.Г.Гурвичем и начал понимать ген. код. Ближе всего Цзян Кань Джень, Казначеев, R.A.Miller и P.Marcer . Но это близкое далеко. Даже они не понимают, что фишка в правильном понимании белкового ген. кода. Но его ложная модель вбита Ниренбергом ржавыми гвоздями в медные головы генетиков и мол. биологов. Вот мои последние две статьи в OJGEN, которые сто раз здесь цитировал, прочитал-ли кто нибудь тут? Я же там все разжевал. По-моему, только Вы и поняли. А за бугром эти статьи только массово скачивают ... и ни одного комментария. НО в редакцию обращаются, чтобы я еще публиковал. Странно, что не ко мне. Не пойму, то-ли не понимают (в это не верю), то-ли пытаются что-то сделать в рамках закрытых тем. А это не безопасно... Вчера из редакции еще раз написали, чтобы подготовил дополнительные материалы, а они немедленно опубликуют. Так что в литературе ничего по теме не найдете, кроме моих статей. Найдете только троллей в сети.



Рекрут 10.07.2019 16:43
Насчет сметаны и масла. Будет. Все-таки нашлись хорошо соображающие.



Рекрут 11.07.2019 10:58
Asterix, вы бы не затягивали с экспериментом. Есть несколько групп в РАНовских институтах, готовых начать эту работу. Теорию готовлю к публикации. Там же и дам то, что обсуждали с Вами. Как ссылаться на Вас, если не хотите совместную статью? Финансирование, приличное и реальное, обсуждено.



Поклонник Талантов 11.07.2019 12:26
(Рекрут @ 11.07.2019 02:58)
Ссылка на исходное сообщение  Asterix, вы бы не затягивали с экспериментом. Как ссылаться на Вас, если не хотите совместную статью?


user posted image



Asterix 11.07.2019 20:36
Есть несколько групп в РАНовских институтах, готовых начать эту работу.

.. Замечательно , так за чем дело стало? я готов поучавствоивать в работе в качестве научного консультанта.. Могу даже праймеры нужные написать и плазмиду-матрицу с ГФП прислать..
. Если конечно сам ИБХ не даст , жадины они там в ЕвроГене , знатные жадины.

меня скромая должность научного консультанта вполне устраивает , ну буду там в Натуре где-то посередине длинного списка соавторов. Я не гордый... Мне пенсию и так уже Бельгийский Бюджет платит. За заслуги в деле биотехнологии.



Рекрут 11.07.2019 23:51
(Asterix @ 11.07.2019 21:36)
Ссылка на исходное сообщение  Есть несколько групп в РАНовских институтах, готовых начать эту работу. 

.. Замечательно , так за чем дело стало?  я готов поучавствоивать в работе в качестве  научного консультанта.. Могу даже праймеры нужные написать  и плазмиду-матрицу  с ГФП прислать..
. Если  конечно сам ИБХ не даст , жадины они там  в ЕвроГене , знатные жадины.

меня  скромая должность научного консультанта вполне устраивает , ну буду там в Натуре  где-то посередине длинного списка соавторов. Я не гордый...  Мне пенсию  и так уже  Бельгийский Бюджет платит.  За заслуги  в деле биотехнологии.

Могли бы с Вашей помощью уже начать. Неужто самому не интересно? Какие проблемы? А если отказываетесь начать сейчас, то начнем позже. Чувствую, денежки хотите. И правильно. Готов оплатить, но во второй половине августа. Понятно, денежки вперед. Но не всегда это быстро. Или у Вас другие планы?
Список авторов планировал короткий - Я, Вы и мой помощник. Другой список будет действительно длинным.



Asterix 12.07.2019 01:51
Ну про денюжки - это хорошо , и про вторую половину августа тоже все правильно,

Верной дорогой идете , товарищ



Рекрут 12.07.2019 10:22
А пока над теорией поработаю. Добавлю четкости.



banned sceptique-NMRguy 12.07.2019 15:16
Смотрите не окочурьтесь тама от делирия, пока добавляете своей чёткости.



Рекрут 12.07.2019 15:42
(banned sceptique-NMRguy @ 12.07.2019 16:16)
Ссылка на исходное сообщение  Смотрите не окочурьтесь тама от делирия, пока добавляете своей чёткости.

На небо-то поглядывайте. Уже близко. Перелистываем гая.



banned sceptique-NMRguy 12.07.2019 15:50
Это само собой, конечно близко. Но Вы всё же к сознательно злоупотребляющим доверием женщин и алкоголем ближе, к сожалению. И в этом далеко не небо виновато, а лживый язык и отсутствие совести, дорогой, но пока неуважаемый, Пётр Петрович. Как увидите что Вы наворотили - пишите, мы будем рады что Вы хоть на короткий срок выздоровели.



Рекрут 12.07.2019 17:15
(banned sceptique-NMRguy @ 12.07.2019 16:50)
Ссылка на исходное сообщение  Это само собой, конечно близко. Но Вы всё же к сознательно злоупотребляющим доверием женщин и алкоголем ближе, к сожалению. И в этом далеко не небо виновато, а лживый язык и отсутствие совести, дорогой, но пока неуважаемый, Пётр Петрович. Как увидите что Вы наворотили - пишите, мы будем рады что Вы хоть на короткий срок выздоровели.

А вы, кроме этого стиля "общения", что нибудь по существу сказать можете? Ведь по вашему я сильно неправ в своей работе. И теоретической, и экспериментальной. У вас же наверняка есть аргументы, которыми вы можете сразить меня наповал. Так дайте их. Представляете, как довольны будут мои злопыхатели. Да и себе не откажете в удовольствии. Ну давайте же, будьте смелее. Готов сразиться, но в честном бою. Вы же джентльмен. smile.gif



Рекрут 12.07.2019 18:58
Видите, струсил гай. Помалкивает. Не удивлюсь, если перейдет на мат. Или забанят. Проходили. Таких надо брать прямо за вымя. Тут трудно, они здесь хозяева, модераторы. Но за пределами этого хозяйства можно. На одного такого негодяя, прямо и публично оскорблявшего меня в явно постановочном ролике, подал в суд. Вчинил ему иск на приличную сумму. Одно заседание суда уже было. В суд сей господин не явился, тоже струсил. Будет и второе.



vb 12.07.2019 19:06
(Рекрут @ 12.07.2019 16:58)
Ссылка на исходное сообщение   Таких надо брать прямо за вымя. .

О, узнаю лексикон незабвенного остапа ибрагимовича.
с такими талантами и прозябаете. Вам в банковский сектор надо было, микрокредитами заниматься. Это ваше.



Рекрут 12.07.2019 20:30
А что за никами спрятались? Трусите. Давайте все данные о вас. По крайней мере, тогда можно попытаться в судебном порядке восстановить справедливость. Покарать вас, безнаказанно годами оскорбляющих людей.



Рекрут 13.07.2019 11:30
to Asterix

Начал собирать и перелопачивать всё по будущей теор-экспериментальной статье.



Vadim Sharov 13.07.2019 14:38
Вот здесь на волновую генетику точно дадут.

Министр просвещения Израиля, раввин Рафи Перец, заявил, во время заседания правительства во вторник (9 июля), что массовая ассимиляция среди евреев разных стран мира, особенно в США, сродни «второму Холокосту».
https://cursorinfo.co.il/all-news/ministr-p...toroj-holokost/ ( https://cursorinfo.co.il/all-news/ministr-prosveshheniya-izrailya-braki-evreev-s-neevreyami-vtoroj-holokost/ )




Рекрут 13.07.2019 14:56
(Vadim Sharov @ 13.07.2019 15:38)
Ссылка на исходное сообщение  Вот здесь на волновую генетику точно дадут.

А на лингвистическую?



Рекрут 14.07.2019 11:15
Астерикс: "Семь раз отмерь ...", а отрежут другие (Жванецкий).

ПГ: Ваша идея, что Метиониновый сиом - всему голова в виртуальных перекодировках кодонов, красивая. Но генетически не аккуратная. С него вполне хватит роли рисовальщика заглавных букв в ген. текстах. Роль вирт. перекодировщиков распределена между всеми 32 сиомами, включая Мет. сиом. Эти 32 сиома задают динамизм ген. коду, где правит непостоянное постоянство и постоянное непостоянство. Вспоминаем Хесина и его монографию "Непостоянство генома". https://booksee.org/book/724765 ( https://booksee.org/book/724765 )
Прав был старина, но не додумал поглубже.



vb 15.07.2019 08:17
(Vadim Sharov @ 13.07.2019 12:38)
Ссылка на исходное сообщение  Вот здесь на волновую генетику точно дадут.

Поржал. Комменты доставляют.
а че, правда, гаряй к евреям не подался? Перед рпц лебезил, лебезил, но ниче не обломилось, а там вишь какие безбашенные есть.



Рекрут 15.07.2019 11:10
(vb @ 15.07.2019 09:17)
Ссылка на исходное сообщение  Поржал. Комменты доставляют.
а че, правда, гаряй к евреям не подался? Перед рпц лебезил, лебезил, но ниче не обломилось, а там вишь какие безбашенные есть.

Да что ж вы злобные такие? Жизнь что-ли не удалась?



Asterix 15.07.2019 15:45
Петрович , тролли - это реальность сети ... Они может вообще роботы , откуда вы знаете что они живые? Такие чат-боты очень несложно делаются ...

Вот посмотрите сколько вот мы с вами плодотворно наобсуждали в теме... ... Вам же просто нужен человек который спокойно обсуждает с вами ваши идеи не скатываясь в брань и дебильные шуточки. Живой человек.

Вот вы и получили такое обсуждение ... я вам его просто подарил, без личного интереса.

теперь у вас есть о чем подумать и как модифицировать вашу теорию и какие эксперименты надо поставить, и что поискать в литературе, итд ...
Ну прекрасно же? не правда ли прекрасно?

Я похоже нединственный кто может вот так спокойно и без истерик обсуждать Волновую Генетику. Поскольку у меня есть кроме научного еще и эзотерическое образование и никакой пробкемы тут я не нахожу.

У вас совершенно замечательная генетическая теория, производная от древних эзотеричесих идей устройства мира и для перевода ее в класс современного научного знания просто требуется грамотно поставить эксперименты.



LMP 15.07.2019 17:21
(Asterix @ 15.07.2019 13:45)
Ссылка на исходное сообщение  Петрович ,  тролли - это реальность сети ... Они может вообще  роботы , откуда вы знаете что они живые?  Такие чат-боты  очень несложно делаются ...
правильно! давно подозревал, что заместо ппг бишет бот, а то и два



Рекрут 15.07.2019 17:54
(Asterix @ 15.07.2019 16:45)
Ссылка на исходное сообщение  Петрович ,  тролли - это реальность сети ... Они может вообще  роботы , откуда вы знаете что они живые?  Такие чат-боты  очень несложно делаются ...

Вот посмотрите  сколько вот мы с вами плодотворно наобсуждали  в теме... ... Вам же просто нужен человек который спокойно обсуждает  с вами ваши идеи не скатываясь  в брань  и дебильные шуточки. Живой человек.

Вот вы и получили такое обсуждение ... я вам его просто подарил, без  личного интереса.

теперь у вас есть о чем подумать и как модифицировать  вашу теорию  и какие эксперименты надо поставить, и что поискать в литературе,  итд ...
Ну прекрасно же? не правда ли прекрасно?

Я похоже нединственный кто может вот так спокойно и без истерик  обсуждать Волновую Генетику.  Поскольку у меня есть кроме научного еще и эзотерическое образование  и  никакой пробкемы  тут я не нахожу.

У вас совершенно замечательная  генетическая  теория,  производная от  древних эзотеричесих  идей устройства мира  и для перевода ее в класс современного научного знания  просто требуется грамотно поставить эксперименты.

Пожалуй так. Да и Вы не в накладе. Яснее стало, как ставить эксперимент. И все очевиднее, что можно было бы и не ставить никаких экспериментов, разве что для красоты - с зеленым белком. Достаточно было сопоставить кодоны и аминокислоты на больших белкАх, на сотнях таких белков и их мРНК. С большой статистикой. Но этого ПРИЦЕЛЬНО НЕТ. Было бы, тогда рухнет этот колосс на глиняных ногах - оФИГциальная генетика. Но даже сейчас ясно, что статичная таблица Кода мертва. Она убита рекомбинаторной динамикой кодонов, запускаемой сиомами.

Реальный Код дышит, движется, комбинирует и соображает далеко за пределами навязанной Таблицы.



Поклонник Талантов 15.07.2019 21:57
Нее.. ну вы когда будете делать свой самый главный эксперимент,
все в нетерпении..



Рекрут 15.07.2019 23:55
(Поклонник Талантов @ 15.07.2019 22:57)
Ссылка на исходное сообщение  Нее.. ну вы когда будете делать свой самый главный эксперимент,
все в нетерпении..

Де факто он уже сделан как очевидная мысленная конструкция, опирающаяся на фактические известные структуры генетического (белкового) Кода https://www.scirp.org/journal/paperinformat...x?paperid=85202 ( https://www.scirp.org/journal/paperinformation.aspx?paperid=85202 )
Сделано и обосновано главное - способность кода создавать ментальные не вещественные делегирования СМЫСЛОВ, источником которых является многоликая полисмысловая мРНК. Её идеальная (от Идея) невещественное ментальное построение материализуется в белке-слове. В начале было не словр, но ИДЕЯ, МЫСЛЬ предшествующая СЛОВУ, как материализация ЕГО.
Напомню простейшее, иллюстрирующее это: "Маша, я забыл коГ своего компа". Маша не материально (мысленно) делегирует букву Д и не вещественно достраивает искаженное слово "компа" до правильного - "компЬЮТЕРа". Точно также работают синонимо-омонимические кодоны, СИОМЫ, по команде рибосомы, прочитавшей мРНК и понявшей ошибку в сиоме или множество их в сиомах.
В целом, это соответствует положениям теории информации Клода Шеннона.



Рекрут 16.07.2019 00:00
Главный эксперимент на совести Asterix-a... НО я его понимаю...



vb 16.07.2019 07:21
(Рекрут @ 15.07.2019 21:55)
Ссылка на исходное сообщение  Де факто он уже сделан как очевидная мысленная конструкция, опирающаяся на фактические известные конструкции генетического (белкового) Кода https://www.scirp.org/journal/paperinformat...x?paperid=85202 ( https://www.scirp.org/journal/paperinformation.aspx?paperid=85202 )
Сделано, обосновано главное - способность кода создавать ментальные не вещественные делегирования СМЫСЛОВ, источником которых является многоликая полисмысловая мРНК. Её идеальная невещественная ментальная структура материализуется в белке-слове. В начале было не словр, но ИДЕЯ, МЫСЛЬ предшествующая СЛОВУ, как материализация ЕГО.
Напомню простейшее, иллюстрирующее это: "Маша, я забыл коГ своего компа". Маша не материально делегирует букву Д и не вещественно достраивает слово компЬЮТЕРа.  Точно также работают синонимо-омонимические кодоны, СИОМЫ, по команде рибосомы, прочитавшей мРНК и понявшей ошибку в сиоме или сиомах.

Короче говоря, петрпетрович опять слился с экспериментальным подтверждением своих бредней.



Рекрут 16.07.2019 13:15
Asterix - человек порядочный и, кроме того, ему интересно, как мне кажется, поэтому поставит грамотный эксперимент.



Asterix 16.07.2019 13:42
Петровичь , Вы отличный мыслитель эзотерического направления в знании о Природе Вещей.

Рекомендую написать Волновую Генетику как Энеиду, в стихах ... Это сразу придаст новое измерение вашей работе. И именно в поеме вполне уместно будет приобегать к поетическим метафорам , аллюзиям , символам , гиперболам , и прочему богатству лингвистики. Сделайте 64 главки в поеме , по числу кодонов. И каждую главу начинайте именно с ее кодона , первая глава АТГ.

Эксперименты в реале делать незачем , они и так понятны , это же мыслительные конструкции, и если не делать эсперименты - то сразу отпадает куча технических проблем так отягощающих науку, а именно кривые руки экспериментаторов и общая невоспроизводимость результатов которая определяется неизвестными факторами ну и вечное недофинансирование.



Рекрут 16.07.2019 14:51
Финансирование будет Так что прицел не сбивайте.

Относительно Ген Энеиды, мысль блестящая. Но рифмы (кстати, тоже волновой процесс с возвратами ФПУ), у меня слабы. Но в прозе, на Английском, подготовил. Ввести бы туда ключевой эксперимент, что обсуждаем. В Эпилоге. Хотя, Эпилога не будет никогда, как и Мысли.



Рекрут 16.07.2019 17:30
Эпилогом будет его отсутствие.



Рекрут 16.07.2019 20:04
Напомню из-за чего начался тут шум и продолжился в моих статьях. А начался он с написанного Ф Криком в его книге "Безумный поиск":

Вот оригинал написанного Ф.Криком:

“An important point to notice is that although the genetic code has certain regularities—in several cases it is the first two bases that encode one amino acid, the nature of the third being irrelevant—its structure otherwise makes no obvious sense.”

Перевод:
"Важно отметить один момент, что, хотя генетический код имеет определенные закономерности — в некоторых случаях именно первые два основания кодируют одну аминокислоту, характер же третьего основания роли не играет — структура кода в противном случае не имеет никакого очевидного смысла".

Вот это и повернуло генетику и мол. биологию не туда. Ф.Крик не понял: 1. Роль 3-го нуклеотида в кодонах не синонимах, 2. "Противный случай" (сиомы) и есть выход из тупика, куда он и направил нас. А У.Лагерквист в своей формуле, что кодируют "два из трёх" (1-й и 2-й) нуклеотиды во ВСЕХ колонах, поставил жирную точку в этой проблеме. А точка-то фальшивая.

И ведь до сих пор большинство биологов пошло по этой дорожке в никударики. Плохо.



Asterix 17.07.2019 03:45
Да что же в этом плохого-то? Я пользуюсь классической концепцией Генкода на практике .. иа генный инженер, и всегда получаю те результаты которые и ожидаю от генкода.

Ничего особо другого я не видел за много лет опыта. На уровне генома - там другое дело .. там чудеса происходили весьма регулярно ... но это другое измерение в жизни. На базовом уровне гены работают именно так как написано в генкоде . Они есть записи белков и рибосома эти записи читает и делает белки как написано, по-инструкции. Чудесные явления начинаются далее , на следующих уровнях биологических машин-роботов.



Рекрут 17.07.2019 11:58
(Asterix @ 17.07.2019 04:45)
Ссылка на исходное сообщение  Да что же в этом плохого-то? Я пользуюсь классической концепцией Генкода  на практике ..  иа генный инженер,  и всегда получаю те результаты которые и ожидаю  от генкода.

Ничего особо другого  я не видел  за много лет опыта.  На уровне генома - там другое дело ..   там чудеса происходили весьма регулярно  ... но это другое измерение в жизни.  На базовом уровне   гены работают  именно так как написано  в генкоде . Они есть записи белков  и рибосома эти записи читает  и делает белки как написано, по-инструкции.  Чудесные явления начинаются  далее , на следующих уровнях биологических машин-роботов.

Ваша практика, видимо, не очень обширна и непонятных "чудес" у Вас не было. И славно. Но если посмотреть литературу (а в ней чудеса публиковать не рекомендуется, особенно противоречащие догме Ген кода), то они иногда выскакивают, как черти из коробки. Первое чудо увидели отцы ген. кода Ниренберг и Крик (приводил много раз) - это одновременное кодирование кодоном UUU фенил аланина и лейцина. Чего быть не должно. Второе чуда аналогично (тоже приводил) - это статья Туранова и др. об одновременном кодировании кодоном UGA селеноцистенина и цистенина, чего тоже по Догме не должно быть. Но есть и опубликовано. И это КАК БЫ не страшно. Почему? Это же противоречит Догме об однозначности кодирования аминокислот и, следовательно, модель кода Ниренберга-Крика НЕ ВЕРНА. "А нам всё равно" поют зайцы от генетики и мол. биологии. И действительно, чего бояться? Рибосома-то ВЫБИРАЕТ правильную аминокислоту, встретившись с сиом кодоном. Вот и хорошо. А то, что это происходит ВОПРЕКИ Догме, так наплевать и забыть. Но ВЫБОР аминокислот идет по иным законам, которые проигнорированы и не знакомы большинству мол. биологов и генетиков, включая отцов Модели Кода. Однако, игнорирование и не знание законов Лингвистической генетики не избавляет от ответственности. И уже идут суды в США относительно гибели людей сильно накушавшихся ГМ пищи, не говоря уже о массовой гибели пчел и почвенной фауны от ГМ растений.
И опять же временами выскакивают публикации, аж а Натуре, которые ставят генетиков на уши, поскольку Мендель-то оказывается не совсем прав, точнее, совсем не прав. Это о публикации Лолли, Прюита о гене Hot Head A.thaliana (тоже цитировал и комментировал, но забыто и брошено "фтопку" smile.gif). http://www.evolbiol.ru/docs/docs/pruitt2005.pdf ( http://www.evolbiol.ru/docs/docs/pruitt2005.pdf ) А ведь там авторы не заметили и не поняли именно влияние контекстов мРНК на один из сиом кодонов, который, будучи физически неизменным, кодировал, видимо разные аминокислоты одновременно. И при этом, получившиеся разные морфогенетические белки, запускали разные биоморфогенезы, дающие различающиеся фенотипы!. То есть дикий и мутантные аллели гена HOT HEAD, с одинаковыми ДНК последовательностями, давали разные фенотипы у A.thaliana. Вот их замечательная фраза из их статьи:

"In every case the sequence of the reverted HTH allele matched the Ler wild-type sequence exactly."
Перевод: В каждом случае последовательность возвращенного HTH-аллеля точно соответствовал последовательности дикого типа Ler.

Asterix, можете списаться с авторами и повторить их эксперимент. Но списываться бесполезно. Пытался уже. Они настолько напуганы скандалом, разразившемся в генетическом научном мире, что сидят тихо. А Лолли, потеряла работу и вернулась в Канаду преподавать студиозам все того же Менделя, на которого они покусились, сами не подозревая этого.

Кстати, о судах в США по отравлениям ГМ пищей. Производители ГМ, конечно, знать не знают и не хотят знать, что при массовом получении гибридных генов резко возрастает вероятность нехороших контекстов результирующей мРНК. А это не хорошо.



Asterix 17.07.2019 14:09
Ну вот , теперь вы утверждаете что я всю жизнь занимаюсь каким-то злодейским делом .. меняю гены в живых организмах , вообщем как доктор Франкенштайн примерно, а то и похуже. как тот доктор с Острова Моро.

Прдположим Волновая генетика может мне помочь сменить имидж с Монсанто-злодейского на добролюбовно христианский.

Но как? как я должен делать ГМО с учетом вашей теории? Вот конкретно, приведите пример.

Как селать картофекь устойчивый к фитофторе? или к колорадскому жуку? так чтобы не нужно было применять неоникотиноиды которые губят пчел и вообще всех насекомых. А пауки в результате голодают.



banned sceptique-NMRguy 17.07.2019 14:12
Насколько ж разговорчивы одержимые. Это ж просто фонтаны.



Рекрут 17.07.2019 16:09
(Asterix @ 17.07.2019 15:09)
Ссылка на исходное сообщение  Ну вот  , теперь вы утверждаете что я всю жизнь занимаюсь каким-то злодейским делом .. меняю гены  в живых организмах ,  вообщем как доктор  Франкенштайн примерно, а то и похуже.  как тот  доктор  с Острова Моро.

Прдположим Волновая генетика может мне помочь сменить  имидж с  Монсанто-злодейского на добролюбовно  христианский. 

Но как?  как я должен делать  ГМО  с учетом вашей теории?  Вот конкретно, приведите пример.

Как селать картофекь устойчивый к  фитофторе?  или к колорадскому жуку?  так чтобы не нужно было применять  неоникотиноиды которые губят пчел  и вообще всех насекомых.  А пауки  в результате  голодают.

Это просто. Но простота сложная. Для этого Вы должны понимать язык генов и их переводы на язык мРНК. Сейчас невозможно. Особенно, когда монстры ГМ на пути и мелочь, вроде гая. Но без понимания языка и грамматики ДНК-РНК количество пострадавших будет расти. ГМ продукты - бомба замедленного действия, эффективнее взрывающаяся во втором, третьем поколениях. Будет эффект накопления негатива, вырождения людей. На Ваш век хватит, не тронут. Наш с Вами эксперимент будет первым шажком в сторону безопасности ГМ.



Asterix 18.07.2019 00:25
Вы просто гениальны...
/////
Это просто. Но простота сложная.



vb 18.07.2019 04:53
(Asterix @ 17.07.2019 22:25)
Ссылка на исходное сообщение  Вы просто гениальны...
/////
Это просто. Но простота сложная.

Петр петрович давно косит под шизофреника. Надеется, что ему сойдут с рук преступления.



Рекрут 18.07.2019 10:57
(Asterix @ 15.07.2019 16:45)
Ссылка на исходное сообщение  Петрович ,  тролли - это реальность сети ... Они может вообще  роботы , откуда вы знаете что они живые?  Такие чат-боты  очень несложно делаются ...

Вот посмотрите  сколько вот мы с вами плодотворно наобсуждали  в теме... ... Вам же просто нужен человек который спокойно обсуждает  с вами ваши идеи не скатываясь  в брань  и дебильные шуточки. Живой человек.

Вот вы и получили такое обсуждение ... я вам его просто подарил, без  личного интереса.

теперь у вас есть о чем подумать и как модифицировать  вашу теорию  и какие эксперименты надо поставить, и что поискать в литературе,  итд ...
Ну прекрасно же? не правда ли прекрасно?

Я похоже нединственный кто может вот так спокойно и без истерик  обсуждать Волновую Генетику.  Поскольку у меня есть кроме научного еще и эзотерическое образование  и  никакой пробкемы  тут я не нахожу.

У вас совершенно замечательная  генетическая  теория,  производная от  древних эзотеричесих  идей устройства мира  и для перевода ее в класс современного научного знания  просто требуется грамотно поставить эксперименты.

Пожалуй так. Да и Вы не в накладе. Яснее стало, как ставить эксперимент. И все очевиднее, что можно было бы и не ставить никаких экспериментов, разве что для красоты - с зеленым белком. Достаточно было сопоставить кодоны и аминокислоты на больших белкАх, на сотнях таких белков и их мРНК. С большой статистикой. Но этого ПРИЦЕЛЬНО НЕТ. Было бы, тогда рухнет этот колосс на глиняных ногах - оФИГциальная генетика. Но даже сейчас ясно, что статичная таблица Кода мертва. Она убита рекомбинаторной динамикой кодонов, запускаемой сиомами.

Реальный Код дышит, движется, комбинирует и соображает далеко за пределами навязанной Таблицы.



Рекрут 18.07.2019 11:00
(Asterix @ 18.07.2019 01:25)
Ссылка на исходное сообщение  Вы просто гениальны...
/////
Это просто. Но простота сложная.

Не подыгрывайте vb-шникам. Идея проста, но реализовать сложно.



Рекрут 18.07.2019 11:47
Как насчет нашего эксперимента? В конце августа лечу в Лозанну. За фин.поддержкой.



Asterix 18.07.2019 14:40
Лозанна - это прекрасно , Я слышал там живут богатые люди у которых очень много денег. Это факт. Вот инвентор Липитора например .. интереснейшая история у него случилсь с его изобретением ... и однако же бизнес пошел, сначала в Швейцарии, а сейчас уже и в Германии его продают вовсю. 10 млн евро в год приносит.

А давайте сперва разберемся с интерпретацией результатов , ну если получится как ожидается - то все в шоколаде , статью можно в Натуру писать... а если не получится и белок с заменой тирозина на стоп-кодон не будет светиться.. как мы будем такой результат интерпретировать?

И если получится то как мы будем искать этот контекстный сигнал в мРНК? Что бы это могло такое там быть?



Рекрут 18.07.2019 15:52
(Asterix @ 18.07.2019 15:40)
Ссылка на исходное сообщение  Лозанна  - это прекрасно ,  Я слышал там живут богатые люди у которых очень много денег. Это факт.  Вот   инвентор  Липитора например  .. интереснейшая история у него  случилсь  с  его изобретением ... и однако  же бизнес пошел,   сначала в Швейцарии, а сейчас уже и в Германии  его продают  вовсю.  10 млн евро в год приносит.     

А давайте  сперва  разберемся   с интерпретацией результатов , ну если получится  как ожидается   - то  все в шоколаде , статью можно в Натуру писать...  а если не получится  и белок  с заменой тирозина на стоп-кодон не будет светиться.. как мы будем такой результат интерпретировать?

И если получится  то как мы будем искать  этот контекстный сигнал  в мРНК? Что бы это могло такое там быть?

Верно. Мы ничего не знаем о мРНК ЗФБ в аспекте ее смыслового содержания. Если бы она была текстом типа - "я за включение флуоресценции пасть порву любому нуклеотиду!" Тогда все ok. Но мы пока реально читать гены не умеем. Увы. Будем надеяться на подтверждение закона теории информации. В простом изложении - это исправление на выходе ошибки в длинном сообщении, основанном на его смысле. Если не получится флуоресценция, то надо думать, что с мРНК. Вы, помнится, какие-то изменения в контекст гена флуор-го белка вносили? Тогда нужна нативная последовательность гена ЗФБ и, соответственно, его мРНК.



Рекрут 18.07.2019 18:47
Иллюстрация дистанционной квантовой передачи работающего гена NeuN. Из книги Шипов, Гаряев, 2019, Квантовый геном в понятиях теории физического вакуума. Есть в сети.
Это привожу как еще один атрибут генетической информации - ее способность быть в форме вещества и в форме физического поля, предсказанная А.Г.Гурвичем в 1924 году.
Также мы можем передать работающий ген зеленого флуоресцирующего белка и ввести его биосистему-реципиент.

Пояснения.

Опыт - трансляция гена NeuN с помощью лазера по торсионному каналу. Видна яркая флуоресценция белка – продукта гена NeuN, гена, который квантовым путем (с использованием мШЭИ - вторичного излучения лазера ЛГН-3030) перенесен в ядра Мезенхимальных Стволовых Клеток (МСК) - реципиентов (крыс) волновых эквивалентов гена NeuN; Контроль - образец МСК без воздействия мШЭИ. Здесь флуоресценция ядер клеток МСК, сравнимая с опытом, отсутствует, т.е. переноса гена NeuN не произошло.

!-й снимок (верхний) - Контроль, 2-й снимок (нижний) - Опыт.



Файл/ы:

Скачать файл ________.pdf
Размер:: 112.44к
кол-во скачиваний: 5



Скачать файл ____.pdf
Размер:: 120.92к
кол-во скачиваний: 4




banned sceptique-NMRguy 18.07.2019 19:03
Приобщите там Петровича к бельгийским ценным свободных художников. Дайте пробить очередное дно. weep.gif



Рекрут 19.07.2019 11:55
Дно уже пробито. Генетика тонет в бессмысленных исследованиях.



metrim 19.07.2019 13:45
(Рекрут @ 19.07.2019 12:55)
Ссылка на исходное сообщение  Дно уже пробито. Генетика тонет в бессмысленных исследованиях. 
Угу, чего то там непонятное ППГею смешивают в пробирках, что никак ему не помогает продавать мр3-файлы с шумами от блока питания.
Бездушная циничная свора! Пожалейте старика !
Ему уже тяжело собирать бутылки и работать ботом на формах, получая копейки за каждый пост.



Рекрут 19.07.2019 15:17
(metrim @ 19.07.2019 14:45)
Ссылка на исходное сообщение  Угу, чего то там непонятное ППГею смешивают в пробирках, что никак ему не помогает продавать мр3-файлы с шумами от блока питания.
Бездушная циничная свора! Пожалейте старика !
Ему уже тяжело собирать бутылки и работать ботом на формах, получая копейки за каждый пост.

Метриум, метрами вашу безмозглость, конечно, не измерить. Но понять простое даже вы можете. Нам не нужны пробирки. Мы работаем со спинорными полями, несущими биоинформацию.



metrim 19.07.2019 19:48
(Рекрут @ 19.07.2019 16:17)
Ссылка на исходное сообщение  Но понять простое даже вы можете. Нам не нужны пробирки.
Да куда уж нам. Сбор бутылок то - эт пнятное дело не хухры-мухры. Не все одинаково паде у вас то принимают, ну и с конкурентами понятно тебе уже тяжело тягацо. Старый больной гаряша .....



Рекрут 19.07.2019 20:50
Не удастся втянуть меня в вашу привычную словесную грязь и ложь. Купайтесь в этом сами.



metrim 19.07.2019 22:13
Горяич, а када ты в собесе затираешь, что "работал в волногонном институте" - тебе чего отвечают?



Рекрут 19.07.2019 23:42
(metrim @ 19.07.2019 23:13)
Ссылка на исходное сообщение  Горяич, а када ты в собесе затираешь, что "работал в волногонном институте" - тебе чего отвечают?

Туда только за проездным ходил. Не тревожат.



Arbeiter-Samaritier-Bund 20.07.2019 00:06
(Рекрут @ 20.07.2019 00:42)
Ссылка на исходное сообщение  Туда только за проездным ходил. Не тревожат.

https://www.101hotels.ru/main/cities/gatchi...micheskaya.html ( https://www.101hotels.ru/main/cities/gatchina/gostinitsa_akademicheskaya.html )
beer.gif



Arbeiter-Samaritier-Bund 20.07.2019 00:07
(Рекрут @ 20.07.2019 00:42)
Ссылка на исходное сообщение  Туда только за проездным ходил. Не тревожат.


https://yandex.ru/video/search?text=%D0%BE%...izard&noreask=1 ( https://yandex.ru/video/search?text=%D0%BE%20%D0%B1%D0%B5%D0%B4%D0%BD%D0%BE%D0%BC%20%D0%B3%D1%83%D1%81%D0%B0%D1%80%D0%B5%20%D0%B7%D0%B0%D0%BC%D0%BE%D0%BB%D0%B2%D0%B8%D1%82%D0%B5%20%D1%81%D0%BB%D0%BE%D0%B2%D0%BE%20%D1%84%D0%B8%D0%BB%D1%8C%D0%BC%201980%20%D1%81%D0%BC%D0%BE%D1%82%D1%80%D0%B5%D1%82%D1%8C&path=wizard&noreask=1 )



Asterix 20.07.2019 16:42
Scientists Use Lasers To Induce Hallucinations In Mice – What Could Go Wrong?

By Stephen Luntz
19 Jul 2019, 13:03

By careful targeting of specific neurons mice have been fooled into thinking they are seeing a pattern. The work has some exciting potential medical applications, but might be the first stirrings of a liar's paradise, a real-life version of video deepfakes, where it becomes impossible to tell whether what you see, hear or touch is real or simulated.

Optogenetics involves making brain cells produce light-sensitive proteins and stimulating them with pulses of light. Using infrared lasers Professor Karl Deisseroth of Stanford University has made it possible to target specific neurons far more precisely than with the traditional blue-green light.

Deisseroth identified the neurons activated in the visual cortex when mice were shown specific images, in this case, parallel horizontal or vertical lines onscreen. The mice were trained to lick a tube when the lines were in one orientation, and not lick for the other.

In Science, Deisseroth reports that when as few as 20 neurons were stimulated optogenetically to match the responses produced by the desired orientation, they induced activity in the brain cells around them. This, in turn, made the mice respond as if they were seeing the real thing.
First the neurons that respond to a particular pattern were recorded, then the same set of neurons were stimulated to induce the image when it wasn't there. Servick/Science

Three years ago another team used the same technique to induce visions in mice, but back then the work was less targeted. They knew they were making the mice see something that wasn't there, but couldn't be sure what it looked like.

Deisseroth can't tell quite how convincing his hallucination is. Perhaps it still appears blurry or otherwise wrong to the mice. Nevertheless, the hallucinations he has induced are similar enough to the real thing that the mice recognize them and know to lick when appropriate, suggesting the match can't be too bad. "Not only is the animal doing the same thing, but the brain is, too," Deisseroth said in a statement. "So we know we're either recreating the natural perception or creating something a whole lot like it."

Such a simple pattern is obviously easier to replicate than a complex scene, but it's early days for this work.

The frightening aspect of this work is that it may mark the start of a march to where it becomes possible to stimulate neurons to make someone believe they have witnessed something important. Wars have been fought when governments have produced faked evidence of another nation's crimes. Imagine the consequences if they could make their citizens believe they witnessed these things first hand.

Before we have to grapple with those dangers, however, the work could bring major benefits, damping down psychotic hallucinations, for example, rather than inducing them. Another team conducting similar work have expressed the belief they can stimulate neurons that decay in dementia patients, possibly reversing some of the effects.



kenseq 20.07.2019 17:29
(Asterix @ 15.06.2019 04:50)
Ссылка на исходное сообщение  Эзотерическое знание

Краткий курс  эзотерики для Пх.Д.

Меня попросили рассказать о древних знаниях и поделиться своими находками. Материала очень много. Если покажется интересным, буду выкладывать кусочками.
Кусочек первый.
Меня будут упрекать лингвисты в надуманности построений и измышлизмах на тему, но «имеющий уши да услышит».
Был язык человека современного Номо сапиенс создан или он возник из подражания природным звукам? Почему мы не мычим как коровы и не шипим как змеи? Знаем ли мы свой язык и почему мы называем предметы так, а не иначе.
Лингвистика нас учит, что русский язык входит в группу индоевропейских языков наряду с романскими, германскими, персидским и арабским языками. В школе нас учат, что слова имеют неизменяемую корень-основу. Например, в слове «дорога» корень «дорог», а в слове «корова» - «коров». Если отбросить гласные, получим «дрг» и «крв». А в слове «бык» - «бк», в слове «карандаш» - «крндш». Как видим, количество согласных звуков в корнях слов разное. Чаще встречаются два и три. Арабисты скажут, что в арабском языке корни всех слов содержат только три согласных звука. Возможно, среди индоевропейских языков есть и такой, в котором корни всех слов состоят из двух согласных звуков. Поищем его.
Числа и 2 и 3 лежат в основе практически всех структур во вселенной. Но об этом поговорим в другой раз, а сейчас попробуем найти слова на основе числа 2 и реконструировать их смыслы.
Начнем с корня «гр-рг». В санскрите слова читаются слева направо и справа налево. Разберем пока только корень «гр». Согласно фонетическим правилам он дает «куст» корней: «гр-жр-хр-кр-ср», а также «гл-жл-хл-кл-сл». Возьмем только одну огласовку гласным «о». Получим «гор-жор-хор-кор-сор», а также «гол-жол-хол-кол-сол». Из них образуем знакомые ключевые слова: «гора, хоровод, жир, корова» и «голова, холод, кол,жо (е)лтый, солнце». Со словом «сор» разберемся отдельно попозже. Все эти слова образуют группу символов, на которых построены арийские знания, заключенные в скандинавских, славянских, греческих, шумеро-аккадских, египетских и других мифах. Слова могут произноситься по-разному, так как пройден большой исторический путь, но смысловая основа у всех одна.
Во всех мифах есть корова: у скандинавов – Аудумла, у египтян – Хатхор, в Ригведе бог огня Агни – бык, у греков бык Зевс и корова Гера, у шумер – бог неба бык Ану. Бык и корова связаны с небом и солнцем и только Аудумла вылизывает ледяную гору («гр-кр – гора-корова») Имира. Когда Имира убивают боги, из него вытекает горячая красная кровь («гр-кр – горячая кровь»), в которой утонула корова. Небесная корова Хат-Хор рождает солнце Гора («гор – горячий»). В теле горы-коровы течет горячая кровь, а в ее утробе зреет сын-солнце. Само тело должно быть холодным («гор-хол»), а солнце рождается из головы («гор-гол») у коровы между рогами («гор-рог»). Жену Зевса Геру называли «волоокой», а ей в жертву приносились коровы. Бык Зевс-зов громко кричит («гр-гл – глас», «гр-кр – крик»), а раскаты грома («гр – гром») сопровождаются вспышками молнии-зари («сол-зол-зор-зар»). Это полыхает яростный огонь (жар) Агни. Агни золотистого цвета («жол-зол-сол»), он окропляется жиром, так как горящий жир испускает сильный жар («жар-жир»). Брахманы поливали жертвенный костер жиром («жр-гр» - жертва, жерло, горло»). Буддийские монахи в Тибете пьют чай с добавлением жира яка и носят желтые и красные одежды.
ТОРА: " сын мой, будь крайне осторожен при переписывании Слова Божьего, ибо, не дописав один знак или внеся один лишний, ты можешь разрушить всю вселенную". Поменяв одну букву в слове, можно полностью изменить его смысл. Слова - это СМЫСЛЫ.


папа карла а у тебя нет краткого курса для електриков



kenseq 20.07.2019 17:31
(Asterix @ 15.06.2019 04:50)
Ссылка на исходное сообщение  Эзотерическое знание

Краткий курс  эзотерики для Ph.D.

Меня попросили рассказать о древних знаниях и поделиться своими находками. Материала очень много. Если покажется интересным, буду выкладывать кусочками.
Кусочек первый.
Меня будут упрекать лингвисты в надуманности построений и измышлизмах на тему, но «имеющий уши да услышит».
Был язык человека современного Нomo sapiens создан или он возник из подражания природным звукам? Почему мы не мычим как коровы и не шипим как змеи? Знаем ли мы свой язык и почему мы называем предметы так, а не иначе.
Лингвистика нас учит, что русский язык входит в группу индоевропейских языков наряду с романскими, германскими, персидским и арабским языками. В школе нас учат, что слова имеют неизменяемую корень-основу. Например, в слове «дорога» корень «дорог», а в слове «корова» - «коров». Если отбросить гласные, получим «дрг» и «крв». А в слове «бык» - «бк», в слове «карандаш» - «крндш». Как видим, количество согласных звуков в корнях слов разное. Чаще встречаются два и три. Арабисты скажут, что в арабском языке корни всех слов содержат только три согласных звука. Возможно, среди индоевропейских языков есть и такой, в котором корни всех слов состоят из двух согласных звуков. Поищем его.
Числа и 2 и 3 лежат в основе практически всех структур во вселенной. Но об этом поговорим в другой раз, а сейчас попробуем найти слова на основе числа 2 и реконструировать их смыслы.
Начнем с корня «гр-рг». В санскрите слова читаются слева направо и справа налево. Разберем пока только корень «гр». Согласно фонетическим правилам он дает «куст» корней: «гр-жр-хр-кр-ср», а также «гл-жл-хл-кл-сл». Возьмем только одну огласовку гласным «о». Получим «гор-жор-хор-кор-сор», а также «гол-жол-хол-кол-сол». Из них образуем знакомые ключевые слова: «гора, хоровод, жир, корова» и «голова, холод, кол,жо (е)лтый, солнце». Со словом «сор» разберемся отдельно попозже. Все эти слова образуют группу символов, на которых построены арийские знания, заключенные в скандинавских, славянских, греческих, шумеро-аккадских, египетских и других мифах. Слова могут произноситься по-разному, так как пройден большой исторический путь, но смысловая основа у всех одна.
Во всех мифах есть корова: у скандинавов – Аудумла, у египтян – Хатхор, в Ригведе бог огня Агни – бык, у греков бык Зевс и корова Гера, у шумер – бог неба бык Ану. Бык и корова связаны с небом и солнцем и только Аудумла вылизывает ледяную гору («гр-кр – гора-корова») Имира. Когда Имира убивают боги, из него вытекает горячая красная кровь («гр-кр – горячая кровь»), в которой утонула корова. Небесная корова Хат-Хор рождает солнце Гора («гор – горячий»). В теле горы-коровы течет горячая кровь, а в ее утробе зреет сын-солнце. Само тело должно быть холодным («гор-хол»), а солнце рождается из головы («гор-гол») у коровы между рогами («гор-рог»). Жену Зевса Геру называли «волоокой», а ей в жертву приносились коровы. Бык Зевс-зов громко кричит («гр-гл – глас», «гр-кр – крик»), а раскаты грома («гр – гром») сопровождаются вспышками молнии-зари («сол-зол-зор-зар»). Это полыхает яростный огонь (жар) Агни. Агни золотистого цвета («жол-зол-сол»), он окропляется жиром, так как горящий жир испускает сильный жар («жар-жир»). Брахманы поливали жертвенный костер жиром («жр-гр» - жертва, жерло, горло»). Буддийские монахи в Тибете пьют чай с добавлением жира яка и носят желтые и красные одежды.
ТОРА: " сын мой, будь крайне осторожен при переписывании Слова Божьего, ибо, не дописав один знак или внеся один лишний, ты можешь разрушить всю вселенную". Поменяв одну букву в слове, можно полностью изменить его смысл. Слова - это СМЫСЛЫ.

https://www.youtube.com/watch?v=BW6ryhtRF2I ( https://www.youtube.com/watch?v=BW6ryhtRF2I )



Рекрут 20.07.2019 18:02
(Asterix @ 20.07.2019 17:42)
Ссылка на исходное сообщение  Scientists Use Lasers To Induce Hallucinations In Mice – What Could Go Wrong?

By Stephen Luntz
19 Jul 2019, 13:03

By careful targeting of specific neurons mice have been fooled into thinking they are seeing a pattern. The work has some exciting potential medical applications, but might be the first stirrings of a liar's paradise, a real-life version of video deepfakes, where it becomes impossible to tell whether what you see, hear or touch is real or simulated.

Optogenetics involves making brain cells produce light-sensitive proteins and stimulating them with pulses of light. Using infrared lasers Professor Karl Deisseroth of Stanford University has made it possible to target specific neurons far more precisely than with the traditional blue-green light.

Deisseroth identified the neurons activated in the visual cortex when mice were shown specific images, in this case, parallel horizontal or vertical lines onscreen. The mice were trained to lick a tube when the lines were in one orientation, and not lick for the other.

In Science, Deisseroth reports that when as few as 20 neurons were stimulated optogenetically to match the responses produced by the desired orientation, they induced activity in the brain cells around them. This, in turn, made the mice respond as if they were seeing the real thing.
First the neurons that respond to a particular pattern were recorded, then the same set of neurons were stimulated to induce the image when it wasn't there. Servick/Science

Three years ago another team used the same technique to induce visions in mice, but back then the work was less targeted. They knew they were making the mice see something that wasn't there, but couldn't be sure what it looked like.

Deisseroth can't tell quite how convincing his hallucination is. Perhaps it still appears blurry or otherwise wrong to the mice. Nevertheless, the hallucinations he has induced are similar enough to the real thing that the mice recognize them and know to lick when appropriate, suggesting the match can't be too bad. "Not only is the animal doing the same thing, but the brain is, too," Deisseroth said in a statement. "So we know we're either recreating the natural perception or creating something a whole lot like it."

Such a simple pattern is obviously easier to replicate than a complex scene, but it's early days for this work.

The frightening aspect of this work is that it may mark the start of a march to where it becomes possible to stimulate neurons to make someone believe they have witnessed something important. Wars have been fought when governments have produced faked evidence of another nation's crimes. Imagine the consequences if they could make their citizens believe they witnessed these things first hand.

Before we have to grapple with those dangers, however, the work could bring major benefits, damping down psychotic hallucinations, for example, rather than inducing them. Another team conducting similar work have expressed the belief they can stimulate neurons that decay in dementia patients, possibly reversing some of the effects.

Астерикс,
мы используем ничтожный процент возможностей нашего лазера записывать то, что раньше было просто немыслимо. Ведь он способен записывать ВЕСЬ метаболом, в т.ч. метаболом нейронов!
Но можно попытаться записать и ЭЭГ. Ведь ЭЭГ по сути не расшифрованы. Знаю как. Вот где возможности. В том числе реальная телепатия.



shloss3 20.07.2019 18:59
(Asterix @ 15.06.2019 04:50)
Ссылка на исходное сообщение  Эзотерическое знание

Краткий курс  эзотерики для Пх.Д.

Меня попросили рассказать о древних знаниях и поделиться своими находками. Материала очень много. Если покажется интересным, буду выкладывать кусочками.
Кусочек первый.
Меня будут упрекать лингвисты в надуманности построений и измышлизмах на тему, но «имеющий уши да услышит».
Был язык человека современного Номо сапиенс создан или он возник из подражания природным звукам? Почему мы не мычим как коровы и не шипим как змеи? Знаем ли мы свой язык и почему мы называем предметы так, а не иначе.
Лингвистика нас учит, что русский язык входит в группу индоевропейских языков наряду с романскими, германскими, персидским и арабским языками. В школе нас учат, что слова имеют неизменяемую корень-основу. Например, в слове «дорога» корень «дорог», а в слове «корова» - «коров». Если отбросить гласные, получим «дрг» и «крв». А в слове «бык» - «бк», в слове «карандаш» - «крндш». Как видим, количество согласных звуков в корнях слов разное. Чаще встречаются два и три. Арабисты скажут, что в арабском языке корни всех слов содержат только три согласных звука. Возможно, среди индоевропейских языков есть и такой, в котором корни всех слов состоят из двух согласных звуков. Поищем его.
Числа и 2 и 3 лежат в основе практически всех структур во вселенной. Но об этом поговорим в другой раз, а сейчас попробуем найти слова на основе числа 2 и реконструировать их смыслы.
Начнем с корня «гр-рг». В санскрите слова читаются слева направо и справа налево. Разберем пока только корень «гр». Согласно фонетическим правилам он дает «куст» корней: «гр-жр-хр-кр-ср», а также «гл-жл-хл-кл-сл». Возьмем только одну огласовку гласным «о». Получим «гор-жор-хор-кор-сор», а также «гол-жол-хол-кол-сол». Из них образуем знакомые ключевые слова: «гора, хоровод, жир, корова» и «голова, холод, кол,жо (е)лтый, солнце». Со словом «сор» разберемся отдельно попозже. Все эти слова образуют группу символов, на которых построены арийские знания, заключенные в скандинавских, славянских, греческих, шумеро-аккадских, египетских и других мифах. Слова могут произноситься по-разному, так как пройден большой исторический путь, но смысловая основа у всех одна.
Во всех мифах есть корова: у скандинавов – Аудумла, у египтян – Хатхор, в Ригведе бог огня Агни – бык, у греков бык Зевс и корова Гера, у шумер – бог неба бык Ану. Бык и корова связаны с небом и солнцем и только Аудумла вылизывает ледяную гору («гр-кр – гора-корова») Имира. Когда Имира убивают боги, из него вытекает горячая красная кровь («гр-кр – горячая кровь»), в которой утонула корова. Небесная корова Хат-Хор рождает солнце Гора («гор – горячий»). В теле горы-коровы течет горячая кровь, а в ее утробе зреет сын-солнце. Само тело должно быть холодным («гор-хол»), а солнце рождается из головы («гор-гол») у коровы между рогами («гор-рог»). Жену Зевса Геру называли «волоокой», а ей в жертву приносились коровы. Бык Зевс-зов громко кричит («гр-гл – глас», «гр-кр – крик»), а раскаты грома («гр – гром») сопровождаются вспышками молнии-зари («сол-зол-зор-зар»). Это полыхает яростный огонь (жар) Агни. Агни золотистого цвета («жол-зол-сол»), он окропляется жиром, так как горящий жир испускает сильный жар («жар-жир»). Брахманы поливали жертвенный костер жиром («жр-гр» - жертва, жерло, горло»). Буддийские монахи в Тибете пьют чай с добавлением жира яка и носят желтые и красные одежды.
ТОРА: " сын мой, будь крайне осторожен при переписывании Слова Божьего, ибо, не дописав один знак или внеся один лишний, ты можешь разрушить всю вселенную". Поменяв одну букву в слове, можно полностью изменить его смысл. Слова - это СМЫСЛЫ.


астерикс тыб есчо кафку вылжил smile.gif

http://lib.ru/KAFKA/zamok.txt ( http://lib.ru/KAFKA/zamok.txt )



Рекрут 20.07.2019 20:32
Тогда уж лучше "Превращение". Там обратный морфогенез человека в насекомое, что тут у многих происходит. https://www.litmir.me/br/?b=12894&p=1 ( https://www.litmir.me/br/?b=12894&p=1 )



shloss3 20.07.2019 20:47
(Рекрут @ 20.07.2019 21:32)
Ссылка на исходное сообщение  Тогда уж лучше "Превращение". Там обратный морфогенез человека в насекомое, что тут у многих происходит. хттпс://щщщ.литмир.ме/бр/?б=12894&п=1 ( https://www.litmir.me/br/?b=12894&p=1 )

рекрут если недержание желчи то советую beer.gif
https://www.youtube.com/watch?v=umVxAQ9EcQg ( https://www.youtube.com/watch?v=umVxAQ9EcQg )



Рекрут 22.07.2019 11:23
Вам лучше освоить держание рта закрытым.



Рекрут 25.07.2019 19:00
[quote=Рекрут,20.07.2019 19:02]Ссылка на исходное сообщение  
Рекрут: мы используем ничтожный процент возможностей нашего лазера записывать то, что раньше было просто немыслимо. Ведь он способен записывать ВЕСЬ метаболом, в т.ч. метаболом нейронов!
Но можно попытаться записать и ЭЭГ. Ведь ЭЭГ по сути не расшифрованы. Знаю как. Вот где возможности. В том числе реальная телепатия.
Вы явно заинтересованы в коммерциализации проектов. Неужели Вы не понимаете, что работа с головным мозгом человека с позиций лингвистико-волновой генетики - это выход на нейроинтернет. А это супер проект. Расшифровка электроэнцефалограмм - прямой выход на него. Мы соображаем с помощью хромосом нейронов как квантовых биокомпьютеров. Белковый метаболом нейронов - база для нейроинтернета. Почему тут тормоз, непонимание? По простой причине. БелкИ как эквиваленты мыслей неуловимы - быстро распадаются, иначе мозг лопнет. Но они, белкИ, уходят в голографическую память, а если это спинтронные голограммы, то информационная емкость их фактически бесконечная. В этом отношении есть две работы Renato Nobili - как раз о голографической памяти нейронов коры головного мозга. Кратко о них в нашей незаконченной статье https://wavegenetics.org/researches/nelokal...funktsii-mozga/ ( https://wavegenetics.org/researches/nelokalnyie-funktsii-mozga/ )



Рекрут 26.07.2019 13:18
Снова Астериксу



LMP 26.07.2019 18:24
Купи себе шапку с рогами, а то он тебя не видит.



HomaBrut 26.07.2019 19:22
[quote=Рекрут,25.07.2019 20:00]Ссылка на исходное сообщение  [quote=Рекрут,20.07.2019 19:02]Ссылка на исходное сообщение  
Рекрут: мы используем ничтожный процент возможностей нашего лазера записывать то, что раньше было просто немыслимо. Ведь он способен записывать ВЕСЬ метаболом, в т.ч. метаболом нейронов!
Но можно попытаться записать и ЭЭГ. Ведь ЭЭГ по сути не расшифрованы. Знаю как. Вот где возможности. В том числе реальная телепатия.
Вы явно заинтересованы в коммерциализации проектов. Неужели Вы не понимаете, что работа с головным мозгом человека с позиций лингвистико-волновой генетики - это выход на нейроинтернет. А это супер проект. Расшифровка электроэнцефалограмм - прямой выход на него. Мы соображаем с помощью хромосом нейронов как квантовых биокомпьютеров. Белковый метаболом нейронов - база для нейроинтернета. Почему тут тормоз, непонимание? По простой причине. БелкИ как эквиваленты мыслей неуловимы - быстро распадаются, иначе мозг лопнет. Но они, белкИ, уходят в голографическую память, а если это спинтронные голограммы, то информационная емкость их фактически бесконечная. В этом отношении есть две работы Renato Nobili - как раз о голографической памяти нейронов коры головного мозга. Кратко о них в нашей незаконченной статье https://wavegenetics.org/researches/nelokal...funktsii-mozga/ ( https://wavegenetics.org/researches/nelokalnyie-funktsii-mozga/ )
[/quote]
https://www.nature.com/articles/35037782 ( https://www.nature.com/articles/35037782 )



HomaBrut 26.07.2019 19:43
(HomaBrut @ 26.07.2019 20:22)
Ссылка на исходное сообщение  https://www.nature.com/articles/35037782 ( https://www.nature.com/articles/35037782 )

The physics prize went to Andre Geim of the Netherlands
confused.gif confused.gif confused.gif eek.gif eek.gif



HomaBrut 26.07.2019 19:46
(HomaBrut @ 26.07.2019 20:43)
Ссылка на исходное сообщение  The physics prize went to Andre Geim of the Netherlands
confused.gif  confused.gif  confused.gif  eek.gif  eek.gif

https://yandex.ru/search/?lr=103765&text=%D...%BC%D0%B8%D1%8F ( https://yandex.ru/search/?lr=103765&text=%D0%B0%D0%BD%D0%B4%D1%80%D0%B5%D0%B9%20%D0%B3%D0%B5%D0%B9%D0%BC%20%D0%B8%20%D0%BA%D0%BE%D0%BD%D1%81%D1%82%D0%B0%D0%BD%D1%82%D0%B8%D0%BD%20%D0%BD%D0%BE%D0%B2%D0%BE%D1%81%D0%B5%D0%BB%D0%BE%D0%B2%20%D0%BD%D0%BE%D0%B1%D0%B5%D0%BB%D0%B5%D0%B2%D1%81%D0%BA%D0%B0%D1%8F%20%D0%BF%D1%80%D0%B5%D0%BC%D0%B8%D1%8F )


eek.gif confused.gif eek.gif confused.gif



andresmetspalu 26.07.2019 20:26
https://www.google.de/search?source=hp&ei=q...Q4dUDCAc&uact=5 ( https://www.google.de/search?source=hp&ei=qzY7XeuLL5qEk74P6ZGk-AI&q=andreas+metspalu&oq=andreas+metspalu&gs_l=psy-ab.3..0i19l2j0i13i30i19l3j0i8i13i30i19.2171.18469..21325...0.0..0.238.1847.10j5j1......0....1..gws-wiz.....0..0i131j0j0i22i30j33i160._c1Q4tWNqbw&ved=0ahUKEwirjdq3jNPjAhUawsQBHekICS8Q4dUDCAc&uact=5 )



andresmetspalu 26.07.2019 20:28
(andresmetspalu @ 26.07.2019 21:26)
Ссылка на исходное сообщение  хттпс://щщщ.гоогле.де/сеарч?соурце=хп&еи=я...Я4дУДЦАц&уацт=5 ( https://www.google.de/search?source=hp&ei=qzY7XeuLL5qEk74P6ZGk-AI&q=andreas+metspalu&oq=andreas+metspalu&gs_l=psy-ab.3..0i19l2j0i13i30i19l3j0i8i13i30i19.2171.18469..21325...0.0..0.238.1847.10j5j1......0....1..gws-wiz.....0..0i131j0j0i22i30j33i160._c1Q4tWNqbw&ved=0ahUKEwirjdq3jNPjAhUawsQBHekICS8Q4dUDCAc&uact=5 )

приежайте в Тарту получите райсское наслагдение



ППГар 13.08.2019 10:34
Asterix-у

См. мою тему по перекодировкам кодонов.





Powered by Invision Power Board (http://www.invisionboard.com)
© Invision Power Services (http://www.invisionpower.com)