Rambler's Top100
Лёгкая версия форума* Виртуальная клавиатура  English  
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы
Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда | Междисциплинарный биологический онлайн-журналZbio-wiki

NG SEQUENCING · ЖИЗНЬ РАСТЕНИЙ · БИОХИМИЯ · ГОРОДСКИЕ КОМАРЫ · А.А.ЛЮБИЩЕВ · ЗООМУЗЕЙ


Темы за 24 часа  [ Вход* | Регистрация* ]  
   



Форум: 
 

Щёлкните, чтобы внести в Избранные Темы* Генетический код, передача наследственной информации в организме -- проблемы, методы, перспективы --
Операции: Хочу стать куратором* · Подписаться на тему* · Отправить страницу по e-mail · Версия для печати*
Внешний вид:* Схема · [ Стандартный ] · +Перв.сообщ.


Добавить сообщение в темуСоздать новую темуСоздать голосование
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 18.02.2018 19:56     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #51 множественное цитирование

(Neo 777 @ 18.02.2018 17:43)
Ссылка на исходное сообщение  Уважаемый Ино!
Как ты мог заметить, активных тем у меня на форуме не "множество", а всего 7 (соответственно моим интересам), да и выхожу я с изложением своих мыслей на форуме нечасто - один/два раза в неделю, - именно потому, что приходится работать и как-то выживать.
Поскольку идеального места работы - смотрителя маяка (как говорил Эйнштейн) или "свежей головы" в японском нии (с полным пансионом в обоих случаях) - никто не предлагает  shuffle.gif

Уважаемый vb!
Если есть желание и время, обозначь проблему или несколько, которые сейчас "биофармацефтика" пока "пробить" не может. Либо (и) таковые, над которыми бьешься ты у себя в лаборатории или вне ее. Обещаю помозговать над ними, и бескорыстно выдать результаты мозгования (здесь или, при необходимости, на почту) - хотя я больше за открытое обсуждение (но это если есть общее согласие). Некоторый положительный опыт имеется.


мне результаты твоего мозгования нах не нужны, мне результат нужен в виде нтд и, как минимум, лабораторного образца. п...болов своих хватает.

как бы попроще объяснить... вот в моей отрасли каждая "идея" выливается, минимум, в год-полтора очень дорогой и интенсивной работы (это только на лабораторном уровне). поэтому как бы имеет место перепроизводство "идей" и недостаток людей, способных планомерно, на хорошем методологическом и культурном уровне их реализовывать.
ну это я не касаюсь скучных организационных сторон такого "сотрудничества".

Всего благодарностей: 1Поблагодарили (1): Asterix
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 18.02.2018 20:02     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #52 множественное цитирование

да и какие идеи ты сможешь дать?
Придумать новый термин?
типа универсальный препарат бессмертия (УПБ), universal immortality drug (UID)
это я и сам умею smile.gif
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 01.04.2018 20:36     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #53 множественное цитирование

А ты попробуй, vb, обозначить мне проблему (самую ее суть) - хотя бы не здесь, если боишься за свои лавры, а по почте. а я помозгую.
Вдруг, что путное и выйдет. Вся Нобелевка - тебе, не кипишуй wink.gif
Мне доллар дашь, и достаточно smile.gif
Участник оффлайн! Vorona
Постоянный участник
Мурманск



 прочитанное сообщение 01.04.2018 20:47     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #54 множественное цитирование

Можно, я Вам 2 доллара дам, но чтобы Вы перестали тут резвиться?
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 05.04.2018 20:04     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #55 множественное цитирование

Уважаемая Vorona!
А откуда такое неприятие резвости на научном фронте? wink.gif
Вам тоже никто не мешает порезвиться, предложив на всеобщее обозрение пару-тройку собственных теорий по проблемам биологии, молекулярной биологии, генетики и т.д.
Что сдерживает?
Боязнь за лавры (читай - доллары)? Отсутствие идей (это еще хуже)?
Или вас, уважаемая детородная машина, так завалила пробирочная работа и семейный очаг, что и подумать даже не получается?
Можете даже на электронку что-либо прислать, - при деловой переписке я более покладист и учтив к дамам и авторитетам. Может, подружимся, Нобелевку совместную состряпаем wink.gif
Жду письма shuffle.gif
Участник оффлайн! LMP
Постоянный участник



 прочитанное сообщение 06.04.2018 00:30     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #56 множественное цитирование

Он по-моему сайт знакомств с чем-то другим перепутал
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 10.04.2018 15:24     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #57 множественное цитирование

Добавлю несколько своих реплик из другого ресурса,
которые, думаю, будут интересны публике.
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 10.04.2018 15:25     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #58 множественное цитирование

Сколько много бла-бла, и сколько мало конструктивного диалога.
Свалил все в одну кучу. Рассуждаешь то ли как помешанный, то ли как первоклашка.
Никто не говорит, что лично тебя искусственно создали. Тебя то создала мамкина яйцеклетка и папкин сперматозоид.

Речь идет о том, и многие ученые допускают такие возможности:
1) первичные формы жизни (типа "коацерватов") были намеренно завезены на нашу планету другими, более старшими цивилизациями;
2) земной "генетический код" (возможно, существуют и другие его варианты, с другими кодирующими элементами, другими химическими элементами, другими "продуктами кодировки") - конструкция инопланетных ученых;
3) в процессе эволюции жизни на земле генетический год неоднократно подвергался РАЗЛИЧНЫМ манипуляциям со стороны инопланетных ученых, - этим, наряду с естественным отбором, и объясняется многообразие существовавших и существующих видов жизни на Земле. И, в том числе, появление разных видов человека, в том числе "человека разумного".

Что невероятного в таких предположениях? Ведь мы делаем тоже самое у себя в лабораториях. И, надо думать, была бы такая возможность, делали бы и на других планетах, с целью "улучшить под себя" тамошнюю флору и фауну.

И не надо тут приплетать Бога. Бог стоит НАД этой системой - НАД НАШЕЙ ВСЕЛЕННОЙ. И тоже много кое-чего делает. Но не надо путать борщ и макароны. Думается в НАШЕЙ ВСЕЛЕННОЙ существуют многие формы жизни, в том числе разумной. И ничто не мешает их ученым проводить те или иные эксперименты. В том числе в масштабах планет.
Это раз.
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 10.04.2018 15:43     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #59 множественное цитирование

Второе.
ты там заикнулся о том, что в своей жизни "за свои поступки отвечал сам", что "все поступки совершал сам", что ты "не машина" и т.д.
Маленький вопросик: мышь бежит по прямому коридору лабиринта; в его конце - развилка - направо и налево; сколько у мыши вариантов дальнейших действий? два и или три или 4. Конечно, мышь сама "определяет", какое именно действие выбрать: направо, налево, назад, остаться на месте.
Но только она выбирает эти действия В ТОМ ТЕСТ_ЛАБИРИНТЕ, КОТОРЫЙ ЕЙ ПОСТРОИЛ УЧЕНЫЙ; который ее изучает. Причем она не осознает, что ее изучают.

Т.о., за свои поступки-то ты, МОЖЕТ, отвечаешь сам, - да только в том лабиринте, который для тебя намеренно построили те, кто тебя изучают.

Мы - скорее всего - чьи-то подопытные существа; наша вселенная - большая чашка Петри; наша галактика - одна из "лужиц" в этой чашке Петри; наша планета - одна из капель в этой лужице. В "микроскоп" же за нами (и другими звездными цивилизациями нашей вселенной) смотрит тот (те), кого мы называем БОГОМ (богами). Стоит наша чашка у них в термостате, и периодически извлекается для наблюдений.
Такова моя точка зрения.

Это два.
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 10.04.2018 15:43     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #60 множественное цитирование

Третье.
Таракану в нервную систему встроили электроды. Теперь можно джойстиком руководить его движением так, как заблагорассудится экспериментатору. Причем таракан не понимает, что у него электродик в голове.
Вопросик: и что, неужели этот таракан "сам определяет свои поступки", "сам принимает решения" и т.д.??)) Да-да, конечно, иногда сам.
Когда джойстик отключен.

Это три.
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 10.04.2018 15:44     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #61 множественное цитирование

По поводу "подписи" в генетическом коде.

Вот если бы я был тем ученым, который создал и потом редактировал этот генетический код, я бы, в силу своего природного юмора, а так же в качестве теста, действительно зашифровал в нем какое-либо личное послание, типа: "Уважаемые жители третьей планеты от солнца! Данный генетический код создан в 225 году 328 миллионолетия по галактическому летоисчилению Омноуном Тлллиоаном, ученым Межгалактического Института Жизни. Если Вы читаете это послание, значит Вы достигли того уровня развития науки, которого мы считаем достаточным для контакта с Вами. Просьба отправить с Вашей планеты мощнейший, на какой способны, однонаправленный энергетический импульс в сторону Юпитера. Наши станции ожидания его примут, мы с Вами свяжемся. С уважением, Ваши родители."

Так то.
Это тебе на погоны.
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 10.04.2018 20:53     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #62 множественное цитирование

(Neo 777 @ 10.04.2018 13:44)
Ссылка на исходное сообщение  По поводу "подписи" в генетическом коде.

Вот если бы я был тем ученым, который создал и потом редактировал этот генетический код, я бы, в силу своего природного юмора, а так же в качестве теста, действительно зашифровал в нем какое-либо личное послание, типа: "Уважаемые жители третьей планеты от солнца! Данный генетический код создан в 225 году 328 миллионолетия по галактическому летоисчилению Омноуном Тлллиоаном, ученым Межгалактического Института Жизни. Если Вы читаете это послание, значит Вы достигли того уровня развития науки, которого мы считаем достаточным для контакта с Вами. Просьба отправить с Вашей планеты мощнейший, на какой способны, однонаправленный энергетический импульс в сторону Юпитера. Наши станции ожидания его примут, мы с Вами свяжемся. С уважением, Ваши родители."

Так то.
Это тебе на погоны.

Ну это тебе не грозит. Максимум, колорадского жука на мамкином огороде собирать.
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 11.04.2018 17:35     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #63 множественное цитирование

Уважаемый sceptique, спасибо за ссылку, будет интересно почитать!
https://geektimes.ru/post/298091/
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 23.04.2018 23:48     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #64 множественное цитирование

(Neo 777 @ 11.04.2018 17:35)
Ссылка на исходное сообщение  Уважаемый sceptique, спасибо за ссылку, будет интересно почитать!
https://geektimes.ru/post/298091/

Вы это, меня не приплетайте. Я Вам эту ссылку не присылал, не путайте и трезвитесь. А то будет ещё один третьяков на форуме... teapot.gif
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 29.04.2018 20:03     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #65 множественное цитирование

Уважаемый Poll!
Отчасти соглашусь с Вами, допустил некую неточность: редактируют (часто, но не всегда), действительно, НАКОДИРОВАННОЕ с помощью того или иного кода.

Тогда послание, конечно, могло бы выглядеть чуть по-другому:
"Уважаемые жители третьей планеты от солнца! Данный генетический код создан в 225 году 328 миллионолетия по галактическому летоисчилению Омноуном Тлллиоаном, ученым Межгалактического Института Жизни. Если Вы читаете это послание, закодированное с помощью него в Вашей генетической программе, значит Вы достигли того уровня развития науки, которого мы считаем достаточным для контакта с Вами. Просьба отправить с Вашей планеты мощнейший, на какой способны, однонаправленный энергетический импульс в сторону Юпитера. Наши станции ожидания его примут, мы с Вами свяжемся. С уважением, Ваши родители." wink.gif

Хотя, подумав, можно понять, что и код можно редактировать. Это я к тому, что - вы уверены, что ранее (ОЧЕНЬ давно) те же буковки а, г, т, ц (т. е. буквы ЯЗЫКА) не составляли другой код, например тетраплетный, пентаплетный? и т.д.? что не существовали "разные ветви" генетического кода земных организмов? что не существовали абсолютно не известные нам сегодня аминокислоты, кодируемые генетическим аппаратом? что генетический аппарат всегда кодировал лишь структуру белков? И так далее.

Кстати, подумав, можно понять, что если бы была действительно необходимость закодировать в геноме какое-то послание или несколько - оно не должно быть чересчур длинным, как приведено выше. Напротив, чем оно короче, лаконичнее и ёмче по смыслу, тем вернее, что оно сохранится в постоянно трансформирующемся и пертурбирующем геноме. На ум приходит что-то вроде:
"Пальните энергией в Юпитер. Ждем Сигнала. Предки" rolleyes.gif

Мы очень мало знаем. shuffle.gif
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 05.05.2018 17:25     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #66 множественное цитирование

А если еще подумать,
то такое КРАТКОЕ сообщение ("подпись"?) следует искать разбросанным по всему геному клеток (каждой отдельной особи того или иного вида) в виде многократно повторяющихся копий - не несущих какой-либо очевидной генетической функции (кодирующей, регулирующей и пр.).

Не факт, но с точки зрения программиста такую "подпись/послание" логичнее всего разместить именно в многократно дублированных некодирующих последовательностях, чем дополнительно нагружать кодирующие/регулирующие участки.

Да, и еще (это коммент к замечанию товарища Poll,а):
вы должны понимать, что (гипотетическая ситуация) мне как ученому, манипулирующему с буковками генетической информации примитивных существ с планеты ЩШОТР не обязательно (да и невозможно) на данный момент манипуляций знать будущий язык тех развившихся из этих примитивов разумных существ, которые мое послание в своей генетической программе прочитают.
Мне с помощью 4 условных букв А, Г, Т, Ц - нет надобности шифровать "СЛОВА".
Мне достаточно зашифровать, например, некую цифровую информацию, которая ДОСТАТОЧНО РАЗУМНЫМИ читающими будет переведена в понятия и действия.

Например, если принять, что
A = 1;
T = 0;
C = "запятая" [математическая];
G = "знак разделения между цифрами числа", "многоточие"
тогда, например,
число ПИ может выглядеть так:
AAACAGAAAAGAGAAAAAGAAAAAAAAAGAAGААААААGАААААGАААGАААААGGGGGG
3,1415926535......
(не обязательно именно такое распределение смысловой нагрузки среди четырех нуклеотидов; может быть, например: С = 1; G = 0; A = "запятая"; Т = "знак разделения, многоточие")

Этим способом можно ЛЕГКО шифровать: координаты (планет, небесных тел, объектов на них); расстояние; константы, числа, в том числе характеризующие/намекающие на необходимость определенных действий (лазерный импульс, радиоимпульс и т.д.); и так далее и так далее.
Нет ничего трудного зашифровать таким способом:
"Пошлите мощный энергетический импульс с вашей планеты на Юпитер".

Вот так-то.
павлины, говоришь?
shuffle.gif

Сообщение было отредактировано Neo 777 - 07.05.2018 19:38
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 06.05.2018 17:18     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #67 множественное цитирование

Какуюто хню нагенерил и довольный такой, ножкой шаркает. Сам себе нравишься, да, нео?
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 06.05.2018 22:06     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #68 множественное цитирование

(vb @ 06.05.2018 17:18)
Ссылка на исходное сообщение  Какуюто хню нагенерил и довольный такой, ножкой шаркает. Сам себе нравишься, да, нео?

user posted image
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 07.05.2018 19:31     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #69 множественное цитирование

Немного упорядочил свое предыдущее сообщение.
Уважаемый vb!
Почему же хню, мысль на мой взгляд довольно интересная.

Никакие законы биологии, физики или математики не запрещают использовать наш геном для сохранения тех или иных сообщений; в том числе - вышеуказанным способом (как один из вариантов).

Если бы у меня была такая огромная возможность оставить свою "подпись"/сообщение в генетическом материале организмов целой планеты - я бы обязательно это сделал.
Тем более, что, повторюсь - такое "сообщение" ("сообщениЯ") могли быть оставлены не для забавы, а являются критерием достаточного умственного развития существ на этой планете для установления контакта с "родителями": если могут прочесть, значит достаточно развиты и созрели для контакта.

Кстати, при пропускании вышеуказанной нуклеотидной последовательности, шифрующей начальную часть числа Пи, через некоторые базы данных, получаются довольно интересные результаты... wink.gif
(AAACAGAAAAGAGAAAAAGAAAAAAAAAGAAGААААААGАААААGАААGАААААGGGGGG)

И это мы еще не работали с другими константами, другими числовыми эквивалентами тех или иных физических/химических воздействий-взаимодействий.
И пока еще не пробовали других подходов к возможному шифрованию "осмысленной числовой информации" в геноме земных организмов.
shuffle.gif
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 13.08.2019 18:36     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #70 множественное цитирование

Интересная, забытая тема. Надо бы продолжить.
...
Участник оффлайн! ППГар




 прочитанное сообщение 13.08.2019 19:19     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #71 множественное цитирование

(Neo 777 @ 13.08.2019 19:36)
Ссылка на исходное сообщение  Интересная, забытая тема. Надо бы продолжить.
...

Продолжать имеет смысл по работам В.И.Щербака и др., которые доказали, что генетический код белков оперирует понятием нуля.
https://creationist.in.ua/reading/quote/280...herbaka-makukov
https://yandex.ru/search/?clid=9582&text=Sh...&l10n=ru&lr=213
Участник оффлайн! Поклонник Талантов




 прочитанное сообщение 15.08.2019 21:28     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #72 множественное цитирование

Ученый – не тот, кто дает правильные ответы, а тот, кто задает правильные вопросы.

Всего благодарностей: 1Поблагодарили (1): Neo 777
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 16.08.2019 21:42     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #73 множественное цитирование

Нередко необычные и правильные вопросы задают...дети.
Поэтому, не смотря на свои титулы и звания, оставайтесь в душе всегда ребёнком. (с)
shuffle.gif
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 16.08.2019 21:48     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #74 множественное цитирование

ППГ, к слову сказать - я уверен, что в ваших идеях, реально,
есть рациональные зерна. Серьезно. Такие идеи сами по себе не приходят.
Участник онлайн! trava




 прочитанное сообщение 19.08.2019 18:11     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #75 множественное цитирование

Где рациональность? Можете сформулировать?
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 26.08.2019 22:14     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #76 множественное цитирование

"Некоторые соображения о природе и назначении генкода Земных организмов" (с).


«Ваша идея, конечно, безумна. Весь вопрос в том, достаточно ли она безумна, чтобы оказаться верной.»
Нильс Бор - В. Паули.


"Магия - это наука, которую мы пока не понимаем".
А. Кларк.


Сначала несколько общих фраз.
Приглашаю всех к дискуссии.

Как уже неоднократно говорил ранее - генетический код, который мы знаем сейчас - это ещё не до конца прочитанная книга, как уверены в этом многие из нынешних корифеев. Он будет преподносить еще много неожиданностей, в совершенно разных плоскостях. Назову лишь некоторые из наиболее возможных, по моему мнению. Которые нужно не отрицать сразу-с-порога, а в направлении которых нужно - рыть. Причём понимаем, что имею ввиду не только генетический код "венца творения" - человека, но и таковой остальных земных организмов. Насколько верны мои предположения, покажет время и Ваши интенсивные лабораторные исследования.

1. (множественность информационных слоёв генкода).
Есть предположение, что функция генетического кода как такового сводится не только к той общеизвестной работе, которую он совершает в клетке (кодировка белков, регуляция экспрессии генов и т.д.), но и к хранению тех или иных информационных посланий либо - "подписей", зашифрованных в нём созданиями, которые, достаточно вероятно, неоднократно вмешивались в ход эволюционного процесса земных организмов путем манипуляции с генетическим материалом. Главный аргумент в пользу такого предположения - долговечность хранения зашифрованной информации - миллиарды лет. Добавлю ещё одно расширение к данному пункту, специально для умеющих мыслить более широко - данные зашифрованная информация может быть оставлена не обязательно существами, принадлежащими к Нашей Вселенной ("Нашему Пузырю"). Назначение такой зашифрованной информации - авторская подпись и (или) инструкции для связи с теми, кто манипулировал нашим генкодом.

2. (множественность информационных вариантов работы генкода).
Данный тезис как раз о том, что механизмов функционирования генкода в клетке может быть несколько. Два из них - мы более или менее хорошо выучили: триплетами кодируются аминокислоты; последовательностью нуклеотидов кодируются некие регуляторные последовательности, обозначающие, например, места начала транскрипции.
Остальные нам пока не известны, но предположения могут быть таковыми:
- возможно, генкод (физическая последовательность нуклеотидов в днк, рнк), связан с возбуждением-распространением-передачей-хранением неких потоков физических волн разной длины, электрических токов, и т.п., функция которых нам пока не известна. Например, она может быть связана как с работой клетки или внутриорганизменной среды (в т.ч. механизмы памяти например, "аура" и др.), либо со взаимодействием организма с внешней средой ("телепатия", подключение к единому информационному пространству и т.д.).
- возможно, генкод в организме кодирует не только аминокислоты белков, но и некие другие химические соединения.

3. (родственность генкода таковому других внеземных организмов).
Надеюсь, что в относительно ближайшем, и даже скором будущем у нас появится, так или иначе, возможность изучения биологии и системы наследования признаков различных внеземных организмов - большого их числа. Более того - и разумных земных организмов. При этом, я надеюсь, у нас появится возможность почерпнуть огромный пласт новых биологических знаний, в том числе - о видах организации наследственного аппарата. При этом может оказаться, что организация нашего наследственного аппарата - лишь один из распространенных за пределами Земли вариантов. Например, может оказаться, что наиболее распространена в нашем рукаве галактике - десятинуклеотидная система, с кодированием 273 аминокислот (образно). В то время как прочие - 4х, 5и, 7и - нуклеотидные, - являются лишь ее производными (в том числе благодаря искусственным манипуляциям) - и распространены в гораздо меньшей степени.

Наконец, хочу то ли вопрос задать, то ли мыслями неоформленными вслух поделиться...
Допустим, мы достигли такого технического уровня, что у нас есть машинка, которая по нашему желанию может синтезировать днк из любого количества нуклеотидов, как угодно ее порезать на хромосомы, или свернуть в кольцо и т.д. и т.п. т.е. может выполнить любые физические манипуляции над любым количеством нуклеотидов...
И что? Но ведь даже при наличии такой возможности - да? мы ведь все равно сейчас не знаем, ни как организовать взаимодействие генов, ни как задать их работу во времени и организовать взаимный контроль, ни как предусмотреть все их взаимодействия и реакцию на внешнюю среду ...и т.д. и т.д. Т.е. сейчас... мы реально полностью не осознаем, как работает полноценная генетическая программа. Сейчас мы научились лишь небольшим точечным вмешательствам, и то не всегда удачным...
Плохо, товарищи, плохо.
Надо рыть, носом рыть в этом направлении.
Надо развивать не только "железо" в данном направлении, но и наше общее глубокое понимание того, как писать полноценные генетические "программы" с нуля, полностью при этом понимая все особенности их работы и полностью осознавая все свойства получающегося организма.
В целом, думаю, окажется не на много сложнее, чем написание гигантских и архисложных компьютерных программ - которые, тем не менее, успешно нами сейчас пишутся на самых разных языках программирования.

...

Сообщение было отредактировано Neo 777 - 26.08.2019 22:20
Участник оффлайн! Hierophis
Постоянный участник
Україна-єдина!



 прочитанное сообщение 26.08.2019 23:28     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #77 множественное цитирование

хранению тех или иных информационных посланий либо - "подписей", зашифрованных в нём созданиями..... Главный аргумент в пользу такого предположения - долговечность хранения зашифрованной информации - миллиарды лет

А мутации? weep.gif

возможно, генкод (физическая последовательность нуклеотидов в днк, рнк), связан с возбуждением-распространением-передачей-хранением неких потоков физических волн разной длины

Эта идея уже занята )))
Участник оффлайн! Hierophis
Постоянный участник
Україна-єдина!



 прочитанное сообщение 26.08.2019 23:29     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #78 множественное цитирование

Надо рыть

https://www.youtube.com/watch?v=in4-t28-Bmw
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 27.08.2019 04:22     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #79 множественное цитирование

- я вам сейчас помогу. Я буду руководить!
(С) смешарики
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 27.08.2019 19:23     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #80 множественное цитирование

"Некоторые соображения о природе и назначении генкода Земных организмов. 2. " (с)


Hierophis, спасибо за вопрос
("а как же мутации?").
Т.е. ты наверняка этим хотел сказать, что за миллиарды лет мутационный процесс вроде бы должен если не стереть, то прилично подпортить любую "подпись"/инструкцию, оставленную внеземными генными инженерами в наследственном материале земных организмов.
Однако существует несколько возможных вариантов решения данной ситуации - какой из них наиболее верен, я не знаю. Кроме того, возможны и другие механизмы, кроме указанных ниже, не известные ни мне, ни вам.

1. Суперстабильные нуклеотидные последовательности (ССНП) в эухроматине.
Уже сейчас известны белки, аминокислотная последовательность которых оставалась чрезвычайно стабильной тысячи, десятки и сотни тысяч лет (например, цитохромы, гемоглобины, и т.д.) - т.к. от их жесткой стабильности зависит в целом жизнь организма. И таких белков - не один, и не 10, и не 100, а гораздо больше. Особенно если поискать среди ВСЕХ земных организмов.
Соответственно нуклеотидные последовательности, кодирующие такие белки, тоже являются суперстабильными. И, как следствие, являются первыми объектами-кандидатами на обнаружение дополнительных слоёв информации.
Кроме того, суперстабильные нуклеотидные последовательности могут быть обнаружены, или уже известны, в других частях генома - они могут не кодировать непосредственно белки, а выполнять лишь сторонние функции (регуляция транскрипции и др.).

2. Суперстабильные нуклеотидные последовательности в гетерохроматине.
О предназначении гетерохроматиновых районов (участки суперспирализованной нуклеиновой кислоты, "молчащая ДНК") у разных организмов - нам вообще мало что известно. Не известно ни их предназначение, ни скорость мутационного процесса в них, ни подлинных механизмов репарации и т.д. Поэтому и не исключено, что и в гетерохроматиновых районах существуют множественные суперстабильные нуклеотидные последовательности, могущие содержать в себе дополнительные слои информации.

3. Суперстабильные нуклеотидные последовательности хлоропластов, митохондрий.
Кроме указанных выше цитохромов, наследственный материал данных органелл также может иметь множество участков суперстабильных нуклеотидных последовательностей, мало изменяющихся в течение десятков и сотен тысяч лет - и также являющиеся первичными объектами на поиск дополнительных слоев информации в нуклеотидных последовательностях.

4. Миф о мутационном процессе.
Многие биологи разных направлений, даже генетики и молекулярные биологи находятся в плену неверной гипотезы, или убеждения, о том, что мутационный процесс - гигантский по значимости фактор, за несколько тысячелетий прямо нашпиговывающий геном всевозможными мутациями.
Это - не более, чем заблуждение. В противном случае - никакая эволюция не была бы возможна, виды бы просто вымирали за короткое время, не успев начать существовать - именно благодаря бесконечным мутациям в геноме. Между тем в каждой клетке существует - огромное число различных механизмов репарации поврежденной НК; кроме того - клетки генеративных тканей подвержены мутационному процессу в разы меньше, чем клетки остальных тканей; и т.д. В итоге получается, что геном каждого организма (особенно многоклеточного) - это чрезвычайно стабильная система, устойчивость которой исчисляется сотнями тысяч, в отдельных случаях - миллионами лет. А значит - удобен для закладки других слоёв информации в нуклеотидные последовательности.
Поэтому ничто не мешало "космическим инженерам", например, оставить в нуклеотидной последовательности дриопитеков (а это - 10-12 млн лет назад!!) иные слои информации во время принудительной коррекции их генома.

5. Суперстабильные виды земных организмов.
Речь идёт прежде всего о т.н. "живых ископаемых" - реликтовых видах растений и животных, дошедшими до нас практически неизменными из далёких геологических эпох. Это - также чрезвычайно удобные кандидаты для закладки в их нуклеотидные последовательности иных слоёв информации - которая успешно сохранилась, учитывая пункты 1-4, десятки миллионов (!!) лет, если не миллиарды лет.

Таким образом,
генетический материал земных организмов представляет довольно перспективную информационную матрицу, для "вшивания" в неё иных слоёв информации. Возможный срок хранения такой информации практически неизменной - от сотен тысяч до сотен миллионов лет.
Возможно, такие слои информации зашиты в геном не только человека, но и множества других организмов, - причем разными группами "космических инженеров", в разное время.
Надо искать.

О назначении данных слоёв информации я уже говорил неоднократно выше.
Здесь кратко повторюсь.
1. "Авторские Подписи", своего рода "Клейма".
2. Те или иные зашифрованные константы, математические соотношения и т.д. - дающие "читающему" понять, что в геном было осуществлено стороннее вмешательство более высокоразвитой формой жизни.
3. Краткие инструкции к действию.
4. Координаты небесных тел, на которых находятся те или иные группы "космических инженеров".

Главный и наиболее общий замысел таких слоёв информации - "если вы их [слои] нашли - значит, созрели для контакта с нами" (маркер развития цивилизации).


Но и не забываем,
что "множественность информационных слоёв генкода" - лишь один из возможных его "сюрпризов", которые будут открыты в относительно недалёком будущем. Второй по значимости возможный "сюрприз" - "множественность информационных вариантов работы генкода" (см. выше).


...

Сообщение было отредактировано Neo 777 - 27.08.2019 20:35
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 27.08.2019 20:00     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #81 множественное цитирование

(Neo 777 @ 27.08.2019 17:23)
Ссылка на исходное сообщение  

О назначении данных слоёв информации я уже говорил неоднократно выше.
Здесь кратко повторюсь.
1. "Авторские Подписи", своего рода "Клейма".
2. Те или иные зашифрованные константы, математические соотношения и т.д. - дающие "читающему" понять, что в геном было осуществлено стороннее вмешательство более высокоразвитой формой жизни.
3. Краткие инструкции к действию.
4. Координаты небесных тел, на которых находятся те или иные группы "космических инженеров".


какаято ахинея. а нафига ентим инженеграм записывать константы в геном крокодила?!
Участник онлайн! trava




 прочитанное сообщение 27.08.2019 21:19     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #82 множественное цитирование

(Neo 777 @ 26.08.2019 23:14)
Ссылка на исходное сообщение  
"Некоторые соображения о природе и назначении генкода Земных организмов" (с).


«Ваша идея, конечно, безумна. Весь вопрос в том, достаточно ли она безумна, чтобы оказаться верной.»
Нильс Бор - В. Паули.


"Магия - это наука, которую мы пока не понимаем".
А. Кларк.


Сначала несколько общих фраз.
Приглашаю всех к дискуссии.

Как уже неоднократно говорил ранее - генетический код, который мы знаем сейчас - это ещё не до конца прочитанная книга, как уверены в этом многие из нынешних корифеев. Он будет преподносить еще много неожиданностей, в совершенно разных плоскостях. Назову лишь некоторые из наиболее возможных, по моему мнению. Которые нужно не отрицать сразу-с-порога, а в направлении которых нужно - рыть. Причём понимаем, что имею ввиду не только генетический код "венца творения" - человека, но и таковой остальных земных организмов. Насколько верны мои предположения, покажет время и Ваши интенсивные лабораторные исследования.

1. (множественность информационных слоёв генкода).
Есть предположение, что функция генетического кода как такового сводится не только к той общеизвестной работе, которую он совершает в клетке (кодировка белков, регуляция экспрессии генов и т.д.), но и к хранению тех или иных информационных посланий либо - "подписей", зашифрованных в нём созданиями, которые, достаточно вероятно, неоднократно вмешивались в ход эволюционного процесса земных организмов путем манипуляции с генетическим материалом. Главный аргумент в пользу такого предположения - долговечность хранения зашифрованной информации - миллиарды лет. Добавлю ещё одно расширение к данному пункту, специально для умеющих мыслить более широко - данные зашифрованная информация может быть оставлена не обязательно существами, принадлежащими к Нашей Вселенной ("Нашему Пузырю"). Назначение такой зашифрованной информации - авторская подпись и (или) инструкции для связи с теми, кто манипулировал нашим генкодом.

2. (множественность информационных вариантов работы генкода).
Данный тезис как раз о том, что механизмов функционирования генкода в клетке может быть несколько. Два из них - мы более или менее хорошо выучили: триплетами кодируются аминокислоты; последовательностью нуклеотидов кодируются некие регуляторные последовательности, обозначающие, например, места начала транскрипции.
Остальные нам пока не известны, но предположения могут быть таковыми:
- возможно, генкод (физическая последовательность нуклеотидов в днк, рнк), связан с возбуждением-распространением-передачей-хранением неких потоков физических волн разной длины, электрических токов, и т.п., функция которых нам пока не известна.

Тут достаточно много наработано. Это исследования R.A.Miller, P.Marcer, Цзян Кань Джен, В.П.Казначеев, и наши исследования

Например, она может быть связана как с работой клетки или внутриорганизменной среды (в т.ч. механизмы памяти например, "аура" и др.), либо со взаимодействием организма с внешней средой ("телепатия", подключение к единому информационному пространству и т.д.).
- возможно, генкод в организме кодирует не только аминокислоты белков, но и некие другие химические соединения.

Тоже многое нами уже проработано. Белковый код важен, но он не единственный. На другом уровне кодирует поляризационная (спинтронная) ген. информация. Она выполняет роль пространственно-временнОй разметки развивающегося и взрослого организма

3. (родственность генкода таковому других внеземных организмов).
Надеюсь, что в относительно ближайшем, и даже скором будущем у нас появится, так или иначе, возможность изучения биологии и системы наследования признаков различных внеземных организмов - большого их числа. Более того - и разумных земных организмов. При этом, я надеюсь, у нас появится возможность почерпнуть огромный пласт новых биологических знаний, в том числе - о видах организации наследственного аппарата. При этом может оказаться, что организация нашего наследственного аппарата - лишь один из распространенных за пределами Земли вариантов. Например, может оказаться, что наиболее распространена в нашем рукаве галактике - десятинуклеотидная система, с кодированием 273 аминокислот (образно). В то время как прочие - 4х, 5и, 7и - нуклеотидные, - являются лишь ее производными (в том числе благодаря искусственным манипуляциям) - и распространены в гораздо меньшей степени.

Более вероятна универсальная модель белкового кода. Язык ДНК-белковых генов универсален. Своего рода Вселенское эсперанто. Он не исключает огромного разнообразия форм Живого. Триплетный код виден даже из космоса. Это пирамиды, основанные на 4-х буквах ген. кода - А. Т. Г, Ц, (нижние углы пирамиды) а также на числе 2 - кодирующие первые два нуклеотида в кодонах. Третий на вершине - вобулирует (по Ф.Крику). И не зря вобулирует, переводя код в разумно-текстовый режим. В итоге, грани пирамиды образованы тройками букв Кода. Троица - Отец, Сын и Святой Дух. Последнее - квантовый уровень кодирования.  Из Космоса видны пирамиды, говорящие о наличии Жизни на Земле на основе триплетного белкового кода

Наконец, хочу то ли вопрос задать, то ли мыслями неоформленными вслух поделиться...
Допустим, мы достигли такого технического уровня, что у нас есть машинка, которая по нашему желанию может синтезировать днк из любого количества нуклеотидов, как угодно ее порезать на хромосомы, или свернуть в кольцо и т.д. и т.п. т.е. может выполнить любые физические манипуляции над любым количеством нуклеотидов...
И что? Но ведь даже при наличии такой возможности - да? мы ведь все равно сейчас не знаем,  ни как организовать взаимодействие генов, ни как задать их работу во времени и организовать взаимный контроль, ни как предусмотреть все их взаимодействия и реакцию на внешнюю среду ...и т.д. и т.д. Т.е. сейчас... мы реально полностью не осознаем, как работает полноценная генетическая программа. Сейчас мы научились лишь небольшим точечным вмешательствам, и то не всегда удачным...
Плохо, товарищи, плохо.

Хорошо уже то, что понятна логика виртуально-реальных перекодировок как букв в триплетах, так и самих триплетов. По сути, это фрактальный язык генома с разными смысловыми размерностями.

Надо рыть, носом рыть в этом направлении.
Надо развивать не только "железо" в данном направлении, но и наше общее глубокое понимание того, как писать полноценные генетические "программы" с нуля, полностью при этом понимая все особенности их работы и полностью осознавая все свойства получающегося организма.

Железо - это хард (ДНК-последовательности белковых генов), софт генома - программы - разные и многоэтажные (фрактальные). Максимальное фрактальное сжатие ген. программ - арифметика с использованием абстрактного человеческого понятия нуля. (работы В.И.Щербака). И в этом магия генетического кода белков - эквивалентов материализующихся в слове (текстах) идей.

В целом, думаю, окажется не на много сложнее, чем написание гигантских и архисложных компьютерных программ - которые, тем не менее, успешно нами сейчас пишутся на самых разных языках программирования.

...
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 28.08.2019 21:01     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #83 множественное цитирование

Трава - ППГ,
ваш терминологический аппарат настолько путанен, расплывчат и косноязычен,
что отталкивает даже тех, кто хотел бы найти в ваших идеях хоть какое-то рациональное зерно, или несколько.
Участник онлайн! trava




 прочитанное сообщение 28.08.2019 21:33     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #84 множественное цитирование

(Neo 777 @ 28.08.2019 22:01)
Ссылка на исходное сообщение  Трава - ППГ,
ваш терминологический аппарат настолько путанен, расплывчат и косноязычен,
что отталкивает даже тех, кто хотел бы найти в ваших идеях хоть какое-то рациональное зерно, или несколько.

Позавчера в Лондоне на межд. симп. по эвол. сознания докладывал эти идеи. Мягко говоря, с энтузиазмом и шумно приняли. Так что причина Вашего непонимания - как и раньше отмечал, низкий уровень начальной биологической подготовки и, увы, полудетский интеллект. И лень. Не читаете статьи. Тормоз в развитии.
Участник онлайн! trava




 прочитанное сообщение 28.08.2019 21:42     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #85 множественное цитирование

(vb @ 06.05.2018 18:18)
Ссылка на исходное сообщение  Какуюто хню нагенерил и довольный такой, ножкой шаркает. Сам себе нравишься, да, нео?

Точно. И при этом захлебывается в самолюбовании. Но, по сути, туп.
Участник оффлайн! Hierophis
Постоянный участник
Україна-єдина!



 прочитанное сообщение 28.08.2019 21:50     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #86 множественное цитирование

Ну ладно, ворчание и снобизм vb и других скажем так "представителей официальной науки" понятен, но что мне не понятно, так это грызня между собой ППГ, Нео, и других "альтернативщиков", это ж как минимум не логично umnik.gif Нужно вам обьединиться да взять и как нагнать волну, чтоб аж ух, а нет, грызутся weep.gif
Участник онлайн! trava




 прочитанное сообщение 29.08.2019 10:22     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #87 множественное цитирование

(Hierophis @ 28.08.2019 22:50)
Ссылка на исходное сообщение  Ну ладно, ворчание и снобизм vb и других скажем так "представителей официальной науки" понятен, но что мне не понятно, так это грызня между собой ППГ, Нео, и  других "альтернативщиков", это ж как минимум не логично umnik.gif Нужно вам обьединиться да взять и как нагнать волну, чтоб аж ух, а нет, грызутся weep.gif

В дискуссиях надо быть самокритичным и честным, что нацело отсутствует у этого НЭО. Это раздражает и не способствует объединению. Да и на "альтернативщика" он не тянет со своим детским лепетом безграмотного в генетике и мол. биологии.
Участник онлайн! trava




 прочитанное сообщение 31.08.2019 21:34     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #88 множественное цитирование

to Neo

"Главный и наиболее общий замысел таких слоёв информации - "если вы их [слои] нашли - значит, созрели для контакта с нами" (маркер развития цивилизации).
Но и не забываем,
что "множественность информационных слоёв генкода" - лишь один из возможных его "сюрпризов", которые будут открыты в относительно недалёком будущем. Второй по значимости возможный "сюрприз" - "множественность информационных вариантов работы генкода" (см. выше)."

ПГ: Сюрпризов нет. Просто надо знать уже опубликованное относительно "слоёв ген. кода" и, что одно и тоже, его "множественности". Ген код плюралистичен хотя бы потому, что имеет два вектора (с подвекторами) - 1-й - его текстовость или лингвистичность, частью которых выступает математический язык генома (работы В.И.Щербака). И менее жесткие языки, основанные на множественных перекодировках кодонов, благодаря чему таблица Кода может быть правильно трактована только как непрерывно динамичная, не стационарная. Что идет от идеи Ф.Крика о вобулировании 3'-нуклеотидов в сиом кодонах. Это выход на необъятные горизонты текстового программирования генома. 2-й вектор связан с фантомной и ФПУ памятью ДНК. Это механизмы организации биоморфогенеза и его постэмбриональных форм, что опубликовано мной и нами. Все приводил здесь и в мол. и клет. биологии.

Сообщение было отредактировано trava - 31.08.2019 21:37
Участник оффлайн! Neo 777
Участник



 прочитанное сообщение 04.09.2019 20:20     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #89 множественное цитирование

Петр Петрович,
повторюсь, не обижайтесь:
ваша терминология расплывчата, путана, неудобочитаема, и даже местами корява - что, во-первых, действительно отпугивает тех, кто хотел бы искать истинные зёрна в ваших построениях, и, во-вторых, создаёт впечатление, что вы маскируете такой расплывчатой терминологией многие вещи, которые вам самому не понятны, хотя нередко вы делаете вид, что, напротив, абсолютно понятны. Это как школяры, желающие выдать свою диссертацию за "значимое исследование", нашпиговывают ее различными заумными терминами - чтобы потом десятки раз шлифовать диссертацию по воле оппонентов и рецензентов.
Например, ваш "сиом" - просто бесит, поскольку искуственен и незапоминающийся, а "вобулирует" - напоминает рыбу воблу. И т.д.

Но это ладно.
Из всего того огорода, который вы вечность городите, - думаю, людям и на всяческих "симпозиумах", и на форумах, и т.д. - просто не понятно, в каком направлении ручками работать, что искать. Или и вам тоже не понятно?

Все гениальное - в итоге просто, и это не только слова.

Вот мои позиции по генкоду ясны и прозрачны.
В нём надо искать:
1. Подписи-послания-инструкции тех, кто, возможно, неоднократно занимался его редакцией как у нас с вами, так и у других земных существ на нашей планете. Причем надо обратить внимание на возможную кодировку в буковках генкода различных констант, физических величин, даже координат звезд, планет, галактик.
Это ровно то, что земляне отправили в космос на летающей консервной банке - спутнике с пластиной, несущей основную информацию о Земле и ее обитателях. Только срок жизни спутника - в лучшем случае века, а срок жизни информации в генкоде - от сотен тысяч до миллиардов лет.

2. Надо искать другие варианты работы генкода, кроме кодировки белков и осуществление регуляторных функций опять этой же кодировки белков, а именно:
а) как это не безумно звучит, а генкод может кодировать, теоретически, и другие какие-нибудь вещества (просто на данный момент эта причинно-следственная связь не установлена, поскольку о её возможности просто не задумывались - т.к. табу.)
б) генкод может участвовать в физических процессах внутри и вне организма, обусловленных переносом тех или иных волн, взаимодействием с физическими полями и т.д. (реально лес со множеством нехоженых троп).

3. Надо учиться писать полноценные генетические программы/подпрограммы в осязаемо короткие сроки - в результате чего мы выходим на создание новых организмов с заранее заданными свойствами и программируемым внешним видом, циклом развития и т.д. и.д. - либо на полноценное копирование уже имеющихся / имевшихся ранее организмов.

Это - три основных направления, по которым должна двигаться молекулярная биология и генетика в сравнении с тем детсадовским уровнем, на котором она находится сейчас, едва-едва умея коряво-коряво и непредсказуемо точечно изменять генетический аппарат, либо предсказуемо - но за излишне огромный промежуток времени (селекция).


Hierophis,
и два слова по поводу "альтернативных наук".
Мое сугубо личное мнение - таковых просто не существует. Есть просто наука - познание окружающего мира. У неё на каждый данный момент есть светлые, значительно исследованные области, и области тёмные - пространства нехоженых троп. Но все это вместе не перестает быть одной общей, большой наукой. Одним общим, большим вопросом. Проходит время, и некоторые темные участки осветляются - то, что раньше считалось невозможным, немыслимым, непонятным с точки зрения снобов от науки - получает обычное научное объяснение.
Земля становится круглой, мыши перестают рождаться из зерна, из астрологии появляется астрономия.
Так что надо не грызться,
а учиться думать,
учиться задавать правильные вопросы,
учиться мыслить шире.
Участник онлайн! trava




 прочитанное сообщение 04.09.2019 22:40     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #90 множественное цитирование

(Neo 777 @ 04.09.2019 21:20)
Ссылка на исходное сообщение  Петр Петрович,
повторюсь, не обижайтесь:
ваша терминология расплывчата, путана, неудобочитаема, и даже местами корява - что, во-первых, действительно отпугивает тех, кто хотел бы искать истинные зёрна в ваших построениях, и, во-вторых, создаёт впечатление, что вы маскируете такой расплывчатой терминологией многие вещи, которые вам самому не понятны, хотя нередко вы делаете вид, что, напротив, абсолютно понятны. Это как школяры, желающие выдать свою диссертацию за "значимое исследование", нашпиговывают ее различными заумными терминами - чтобы потом десятки раз шлифовать диссертацию по воле оппонентов и рецензентов.
Например, ваш "сиом" - просто бесит, поскольку искуственен и незапоминающийся, а "вобулирует" - напоминает рыбу воблу. И т.д.

ПГ: Прием у Вас старый и пошлый - выдавать собственную некомпетентность за достоинство. Вы просто ничего не поняли из написанного мной и нами и поэтому перешли на самое простое доказательство, когда ничего обосновывать не надо, а просто обругать. И КАК БЫ выглядеть убедительно. Для оппонента формула у Вас простая - "чушь все это". Просто, но не гениально, а наборот. И главное. Мы все наши идеи обосновываем теоретически и экспериментально. И публикуем. Опроергайте не руганью, а конкретным разбором наших работ.  Вы что-то опубликовали из своего детского лепета? smile.gif

Но это ладно.
Из всего того огорода, который вы вечность городите, - думаю, людям и на всяческих "симпозиумах", и на форумах, и т.д. - просто не понятно, в каком направлении ручками работать, что искать. Или и вам тоже не понятно?

ПГ: нам что-то понятно. Изучаем даьше. И меня регулярно приглашают выступать на межд. конф-ях и люди просят помочь, когда медицина бессильна. И повторяю, мы публикуемся в рейтинговых журналах - даем и теорию. и практику. Или все они, принимающих наши идеи и практику, - идиоты? Только один вы - правы. Смешно и противно. Что-нибудь сами-то сделали, доказали, опубликовали? ПОКАЖИТЕ. А не трещите попусту.

Все гениальное - в итоге просто, и это не только слова.

ПГ: Вот это точно. Но не про вас, у которого только безграмотный лепет.

Вот мои позиции по генкоду ясны и прозрачны.
В нём надо искать:
1. Подписи-послания-инструкции тех, кто, возможно, неоднократно занимался его редакцией как у нас с вами, так и у других земных существ на нашей планете. Причем надо обратить внимание на возможную кодировку в буковках генкода различных констант, физических величин, даже координат звезд, планет, галактик.
Это ровно то, что земляне отправили в космос на летающей консервной банке - спутнике с пластиной, несущей основную информацию о Земле и ее обитателях. Только срок жизни спутника - в лучшем случае века, а срок жизни информации в генкоде - от сотен тысяч до миллиардов лет.

ПГ: да Вы в нашем-то ген. коде разобрались бы. Если разобрались, то дайте научную критику новых положений, что выдвинул, доказывая, к примеру, двойную  синонимо-омонимическую  вырожденность Кода Белков.  Годами предлагаю это сделать здешним специалистам...  А в ответ тишина... Может, Вы разгромите меня, но не руганью, а по науке. Давайте. Ссылки на наши последние работы давал. Могу повторить.

2. Надо искать другие варианты работы генкода, кроме кодировки белков и осуществление регуляторных функций опять этой же кодировки белков, а именно:
а) как это не безумно звучит, а генкод может кодировать, теоретически, и другие какие-нибудь вещества (просто на данный момент эта причинно-следственная связь не установлена, поскольку о её возможности просто не задумывались - т.к. табу.)

ПГ: ну вот очевидная безграмотность, просто поражающая. Ген код кодирует аминокислоты и стоп позиции. Это целая система сложнейшего метаболизма, настроенная именно на это. В этом плане все давно и четко доказано... Куда вы полезли?
Ну хоть одно доказательство дайте. Позорище ведь.


б) генкод может участвовать в физических процессах внутри и вне организма, обусловленных переносом тех или иных волн, взаимодействием с физическими полями и т.д. (реально лес со множеством нехоженых троп).

ПГ: а тут, где мы изрядно поработали, и не только мы... Ну хоть одну доказательную позицию дайте, а не псевдо научный треск...


3. Надо учиться писать полноценные генетические программы/подпрограммы в осязаемо короткие сроки - в результате чего мы выходим на создание новых организмов с заранее заданными свойствами и программируемым внешним видом, циклом развития и т.д. и.д. - либо на полноценное копирование уже имеющихся / имевшихся ранее организмов.


ПГ: право, противно. О каких программах толкуете для создания новых организмов? Хоть намек дайте, на чем будут основаны сии программы, на других принципах? Каких?
Снова словесный пустой треск... Простой, но не гениальный. Безграмотный.


Это - три основных направления, по которым должна двигаться молекулярная биология и генетика в сравнении с тем детсадовским уровнем, на котором она находится сейчас, едва-едва умея коряво-коряво и непредсказуемо точечно изменять генетический аппарат, либо предсказуемо - но за излишне огромный промежуток времени (селекция).
Hierophis,


ПГ: точечно менять... Это как? По какой-то неведомой программе?  Какой? Снова противный треск пустоты...


и два слова по поводу "альтернативных наук".
Мое сугубо личное мнение - таковых просто не существует. Есть просто наука - познание окружающего мира. У неё на каждый данный момент есть светлые, значительно исследованные области, и области тёмные - пространства нехоженых троп. Но все это вместе не перестает быть одной общей, большой наукой. Одним общим, большим вопросом. Проходит время, и некоторые темные участки осветляются - то, что раньше считалось невозможным, немыслимым, непонятным с точки зрения снобов от науки - получает обычное научное объяснение.
Земля становится круглой, мыши перестают рождаться из зерна, из астрологии появляется астрономия.
Так что надо не грызться,
а учиться думать,
учиться задавать правильные вопросы,
учиться мыслить шире.

ПГ: Это для журнала "Мурзилка"? Туда точно примут...smile.gif


*




Кнопка "Транслит" перекодирует
текст из транслита в кирилицу.
Правила перекодировки здесь;
текст в квадратных скобках'[]'
не преобразуется.
Имя:

 преобразовывать смайлики · показать смайлики
Назначение кнопок:

   Поблагодарить автора сообщения — поблагодарить автора
   Удалить сообщение — удалить
   Редактировать сообщение — редактировать
   Поместить сообщение в колонку новостей — поместить в колонку новостей
   Цитировать — цитировать сообщение
   не входит в цитирование/входит в цитирование — цитировать несколько
   Отметить СПАМ-сообщение — обозначить спам
   Сообщение для модератора — связь с модератором
   Участник онлайн!/Участник оффлайн! — автор онлайн/оффлайн
   Фотография — фотография автора

   - остальные обозначения -
 
   *
« Предыдущая тема · Беседа · Следующая тема »
Быстрый ответДобавить сообщение в темуСоздать новую тему

Rambler   molbiol.ru - методы, информация и программы для молекулярных биологов              

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Ваш форум  ·  redactor@molbiol.ru  ·  реклама  ·  Дата и время: 17.09.19 20:25
Bridged By IpbWiki: Integration Of Invision Power Board and MediaWiki © GlobalSoft