Rambler's Top100
Лёгкая версия форума* Виртуальная клавиатура  English  
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы
Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда | Междисциплинарный биологический онлайн-журналZbio-wiki


Темы за 24 часа  [ Вход* | Регистрация* ]  


Щёлкните, чтобы внести в Избранные Темы* Дырка при амплификации плазмиды -- нужны ваши советы! --
ИнтерЛабСервис - передовые технологии молекулярной диагностики
Операции: Хочу стать куратором* · Подписаться на тему* · Отправить страницу по e-mail · Версия для печати*
Внешний вид:* Схема · [ Стандартный ] · +Перв.сообщ.

Добавить сообщение в темуСоздать новую темуСоздать голосование
Участник оффлайн! igenetic


 прочитанное сообщение 07.10.2019 17:19     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #1 множественное цитирование

Коллеги, может быть вы сталкивались с похожей ситуацией.

Амплифицирую плазмиду размером 4,5 кб с полимеразой Phusion HotStart Fermentas.

Реакцию ставлю с двух фосфорилированных праймеров. Один прямой имеет с 3'-конца копмлементарные матрице 20 нуклеотидов и 20 нуклеотидов на 5'-конце некомплементарные. Обратный праймер полностью комплементарен части матрицы с tac-промотором, таким образом, что на его 5'-конце находится ТА-богатая область -10.

Так вот. Реакция проходит, и при последующем лигировании плазмида зашивается в кольцо, НО. Почти во всех клонах содержится делеция со стороны R-праймера, где область -10. Как правило отсутствуют все 6 букв, иногда меньше. Этот праймер перезаказывала новый и переставляла реакции с разными температурами отжига. Загадка в том (повторюсь), что делеция в итоговой плазмиде только со стороны обратного праймера, в области -10.

Может быть у вас есть какие-то мыли и рекомендации, как избежать такую делецию?

Сообщение было отредактировано igenetic - 07.10.2019 17:26
guest: petr
IP-штамп: frpzMrmKUuRMg

 прочитанное сообщение 14.10.2019 20:58     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #2 множественное цитирование

Посмотреть бы на обратный праймер...
Ну первое что приходит в голову, образование вторичной структуры на конце праймера или амплифицированной плазмиды. Если есть возможность, то я бы удлинил обратный праймер с 5`конца чтобы сделать этот конец более тугоплавким
Участник оффлайн! Herr Opsis

 прочитанное сообщение Сообщение на английском  15.10.2019 07:15     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #3 множественное цитирование

Участник оффлайн! Herr Opsis

 прочитанное сообщение 15.10.2019 07:16     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #4 множественное цитирование

(guest: petr @ 14.10.2019 21:58)
Ссылка на исходное сообщение  Посмотреть бы на обратный праймер...
Ну первое что приходит в голову, образование вторичной структуры на конце праймера или амплифицированной плазмиды. Если есть возможность, то я бы удлинил обратный праймер с 5`конца чтобы сделать этот конец более тугоплавким

вроде ни прямого ни обратного девушка не выставила
Участник оффлайн! Herr Opsis

 прочитанное сообщение Сообщение на английском  15.10.2019 07:26     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #5 множественное цитирование

Участник оффлайн! Herr Opsis

 прочитанное сообщение Сообщение на английском  15.10.2019 07:44     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #6 множественное цитирование

Efficient Long PCR results from the use of two polymerases: a non-proofreading polymerase is the main polymerase in the reaction, and a proofreading polymerase (3' to 5' exo) is present at a lower concentration.
Участник оффлайн! Herr Opsis

 прочитанное сообщение 15.10.2019 08:09     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #7 множественное цитирование

берите плимераз микс нонпруфрид и пруфрид типа клентака и пфу в отношении 10 к 1
праймеры около 40 нт
тяните на 70 дегризов
Участник оффлайн! Herr Opsis

 прочитанное сообщение 15.10.2019 08:30     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #8 множественное цитирование

у меня таже проблема задолбали эти уже пруфрид полимеразы beer.gif jump.gif
Участник оффлайн! genseq
Постоянный участник

 прочитанное сообщение 15.10.2019 10:01     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #9 множественное цитирование

Если делетируется промотор, то причиной может быть штамм-реципиент. При отсутствии в нём репрессора усиленная транскрипция любого гена будет губительной. В результате при трансформации идёт селекция вариантов с повреждённым промотором. И не стоит полагаться на паспортные характеристики штамма-реципиента. Плазмида с репрессорным геном может теряться.
Участник оффлайн! ship
Постоянный участник

 прочитанное сообщение 15.10.2019 15:38     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #10 множественное цитирование

конечную цель манипуляций опишите. то есть задача какая? вставить в плазмиду 20 нуклеотидов?
если да, то делайте по quikchange протоколу с двумя комплементарными праймерами
Участник оффлайн! igenetic


 прочитанное сообщение 17.10.2019 15:09     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #11 множественное цитирование

(ship @ 15.10.2019 16:38)
Ссылка на исходное сообщение  конечную цель манипуляций опишите. то есть задача какая? вставить в плазмиду 20 нуклеотидов?
если да, то делайте по quikchange протоколу с двумя комплементарными праймерами

Задача: просто замена 24 нуклеотидов
Участник оффлайн! igenetic


 прочитанное сообщение 17.10.2019 15:11     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #12 множественное цитирование

(genseq @ 15.10.2019 11:01)
Ссылка на исходное сообщение  Если делетируется промотор, то причиной может быть штамм-реципиент. При отсутствии в нём репрессора усиленная транскрипция любого гена будет губительной. В результате при трансформации идёт селекция вариантов с повреждённым промотором. И не стоит полагаться на паспортные характеристики штамма-реципиента. Плазмида с репрессорным геном может теряться.

Спасибо за мысль! Но в данном случае это исключено, потому что контрольные варианты прекрасно трансформируются и поддерживаются.
Участник оффлайн! ship
Постоянный участник

 прочитанное сообщение 17.10.2019 15:17     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #13 множественное цитирование

(igenetic @ 17.10.2019 13:09)
Ссылка на исходное сообщение  Задача: просто замена 24 нуклеотидов

Делайте по Qiukchange без вариантов. правда праймеры будут длинные. если у вас мало денег или плохо варят праймеры - то могут быть проблемы.

кроме того, чтото мутировать в экспресионной плазмиде - идея не очень хорошая. Ибо после ПЦР у вас нет гарантии того, что гдето не случилась ошибка.

Поэтому я бы вырезал целевой кусок из плазмиды по уникальным рестриктазам ,засунул бы его в любой стандартный вектор, и уже там вставлял 24 нуклеотиды, секвенировал, и потом обратно в конечную плазмиду.
Участник оффлайн! igenetic


 прочитанное сообщение 17.10.2019 15:25     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #14 множественное цитирование

(guest: petr @ 14.10.2019 21:58)
Ссылка на исходное сообщение  Посмотреть бы на обратный праймер...
Ну первое что приходит в голову, образование вторичной структуры на конце праймера или амплифицированной плазмиды. Если есть возможность, то я бы удлинил обратный праймер с 5`конца чтобы сделать этот конец более тугоплавким

R-праймер 5' - 3' cattatacgagccgatgattaattg

В данном случае этот праймер может быть таким и только таким. Увы, удлинить не могу
Участник оффлайн! igenetic


 прочитанное сообщение 17.10.2019 15:31     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #15 множественное цитирование

(ship @ 17.10.2019 16:17)
Ссылка на исходное сообщение  Делайте по Qiukchange без вариантов. правда праймеры будут длинные. если у вас мало денег или плохо варят праймеры - то могут быть проблемы.

кроме того, чтото мутировать в экспресионной плазмиде - идея не очень хорошая. Ибо после ПЦР у вас нет гарантии того, что гдето не случилась ошибка.

Поэтому я бы вырезал целевой кусок из плазмиды по уникальным рестриктазам ,засунул бы его в любой стандартный вектор, и уже там вставлял 24 нуклеотиды, секвенировал, и потом обратно в конечную плазмиду.

Вариант с такой сложной заменой через еще один вектор -- не подходит. Потому что вся задача и состоит в том, чтобы быстро менять эти 24нт, заказывая каждый раз только один F-праймер с различными 24нт.

Про квикчендж сейчас почитаю, спасибо!
guest: petr
IP-штамп: frvKCqje1sDbE

 прочитанное сообщение 18.10.2019 06:06     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #16 множественное цитирование

Если не хотите через второй вектор, то или квыкчейндж, или смотрите по бокам от потенциального места замены уникальные рестриктазы и делаете мутагенез ПЦРом в 2 этапа. В результате ПЦРов у Вас будет "вставка" по этим рестриктазам с нужной Вам последовательностью.

Вам надо сделать 2 ПЦр продукта с перекрывающейся областью (конец первого - перекрытие с началом второго этак на 20-25 нуклеотидов).

Соответственно у Вас 4 праймера:
FW для правого куска: 5`-6 букв + сайт рестрикции + комплементарная часть-3`
Rev для правого куска: 5`-20-25по перекрытие + комплементарная часть-3`

FW для левого куска: 5`-20-25по перекрытие (комплиментарно перекрытию Rev от правого праймера) + комплиментарная часть-3`
Rev для левого куска: 5`-6 букв + сайт рестрикции + комплементарная часть-3`

1. ПЦРите правый и левый куски отдельно (если с плазмиды, то не надо больще 15 циклов делать)
2. смешиваете по 1 мкл из предыдущих ПЦР реакций и ПЦРите с внешними праймерами (тоже самое, 15 циклов - более, чем достаточно).


Удачи Вам!
Участник оффлайн! igenetic


 прочитанное сообщение 18.10.2019 13:28     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #17 множественное цитирование

(guest: petr @ 18.10.2019 07:06)
Ссылка на исходное сообщение  Если не хотите через второй вектор, то или квыкчейндж, или смотрите по бокам от потенциального места замены уникальные рестриктазы и делаете мутагенез ПЦРом в 2 этапа. В результате ПЦРов у Вас будет "вставка" по этим рестриктазам с нужной Вам последовательностью.

Вам надо сделать 2 ПЦр продукта с перекрывающейся областью (конец первого - перекрытие с началом второго этак на 20-25 нуклеотидов).

Соответственно у Вас 4 праймера:
FW для правого куска: 5`-6 букв + сайт рестрикции +  комплементарная часть-3`
Rev для правого куска: 5`-20-25по перекрытие + комплементарная часть-3`

FW для левого куска: 5`-20-25по перекрытие (комплиментарно перекрытию Rev от правого праймера) + комплиментарная часть-3`
Rev для левого куска: 5`-6 букв + сайт рестрикции + комплементарная часть-3`

1. ПЦРите правый и левый куски отдельно (если с плазмиды, то не надо больще 15 циклов делать)
2. смешиваете по 1 мкл из предыдущих ПЦР реакций и ПЦРите с внешними праймерами (тоже самое, 15 циклов - более, чем достаточно).


Удачи Вам!

Участник онлайн! Asterix
Постоянный участник

 прочитанное сообщение 18.10.2019 23:54     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #18 множественное цитирование

Однажды мы имели такую проблему , ничего не помогало. Ровно один нуклеотид на конце вставки регулярно исчезал при клонировании ну и рамка считывания сдвигалась.

Решили проблему перекодировав участок вокруг нуклеотида.

Попробуйте, измените последовательность этих шести нуклеотидов так чтоб оно ни на что существенное не влияло. А вдруг сработает еще раз.
Участник оффлайн! igenetic


 прочитанное сообщение 21.10.2019 13:29     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #19 множественное цитирование

(Asterix @ 19.10.2019 00:54)
Ссылка на исходное сообщение  Однажды мы имели такую проблему , ничего не помогало. Ровно один нуклеотид на конце вставки регулярно  исчезал  при клонировании  ну и рамка считывания сдвигалась.   

Решили проблему перекодировав участок вокруг нуклеотида.   

Попробуйте, измените последовательность  этих шести нуклеотидов так чтоб оно ни на что  существенное не влияло. А вдруг сработает еще раз.

Тоже классная идея, возьму на заметку! Спасибо!

Всего благодарностей: 1Поблагодарили (1): Asterix


Кнопка "Транслит" перекодирует
текст из транслита в кирилицу.
Правила перекодировки здесь;
текст в квадратных скобках'[]'
не преобразуется.

 преобразовывать смайлики · показать смайлики
Назначение кнопок:

   Поблагодарить автора сообщения — поблагодарить автора
   Удалить сообщение — удалить
   Редактировать сообщение — редактировать
   Поместить сообщение в колонку новостей — поместить в колонку новостей
   Цитировать — цитировать сообщение
   не входит в цитирование/входит в цитирование — цитировать несколько
   Отметить СПАМ-сообщение — обозначить спам
   Сообщение для модератора — связь с модератором
   Участник онлайн!/Участник оффлайн! — автор онлайн/оффлайн
   Фотография — фотография автора

   - остальные обозначения -
« Предыдущая тема · Молекулярная и клеточная биология · Следующая тема »
Быстрый ответДобавить сообщение в темуСоздать новую тему

Rambler   molbiol.ru - методы, информация и программы для молекулярных биологов              

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Ваш форум  ·  redactor@molbiol.ru  ·  реклама  ·  Дата и время: 13.11.19 15:04
Bridged By IpbWiki: Integration Of Invision Power Board and MediaWiki © GlobalSoft