Rambler's Top100
Лёгкая версия форума* Виртуальная клавиатура  English  
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы
Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда | Междисциплинарный биологический онлайн-журналZbio-wiki

NG SEQUENCING · ЖИЗНЬ РАСТЕНИЙ · БИОХИМИЯ · ГОРОДСКИЕ КОМАРЫ · А.А.ЛЮБИЩЕВ · ЗООМУЗЕЙ


Темы за 24 часа  [ Вход* | Регистрация* ]  
   



Форум: 
 

Щёлкните, чтобы внести в Избранные Темы* Как можно узнать есть ли ДНК в образце после выделения
ИнтерЛабСервис - передовые технологии молекулярной диагностики
Операции: Хочу стать куратором* · Подписаться на тему* · Отправить страницу по e-mail · Версия для печати*
Внешний вид:* Схема · [ Стандартный ] · +Перв.сообщ.


 
Добавить сообщение в темуСоздать новую темуСоздать голосование
Участник оффлайн! DimVik




 прочитанное сообщение 25.12.2020 08:09     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #1 множественное цитирование
Шутка, забавная история
 Господа! Кто знает как определить наличие ДНК в образце после выделения. Электрофореза, спектрофотометра, флуориметра короче, ничего нет. Есть амплификатор Real Time. Буду очень рад Вашему ответу. umnik.gif


Gentlemen! Who knows how to determine the presence of DNA in a sample after isolation. Electrophoresis, spectrophotometer, fluorimeter in short, nothing. There is a Real Time amplifier. I will be very happy to hear from You.
Участник оффлайн! Ash
Участник



 прочитанное сообщение 25.12.2020 20:40     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #2 множественное цитирование

Что за ДНК, каков источник образца?
Участник оффлайн! DimVik




 прочитанное сообщение 11.01.2021 09:53     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #3 множественное цитирование

Здравствуйте! Со всеми прошедшими! Источник ДНК кровь животных (точнее КРС).
Участник оффлайн! Ash
Участник



 прочитанное сообщение 11.01.2021 11:27     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #4 множественное цитирование

Если кроме Real-time у Вас ничего нет, используйте системы для выявления ДНК КРС.
Навскидку что-то вроде https://biochemmack.ru/catalog/element/12760/42076/
Годится?
Участник оффлайн! Ash
Участник



 прочитанное сообщение Сообщение на английском  11.01.2021 16:23     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #5 множественное цитирование

https://www.vniimp.ru/files/abstract/22.05.2012-1.pdf
Участник оффлайн! Ash
Участник



 прочитанное сообщение 11.01.2021 16:29     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #6 множественное цитирование

Тут что-то такое описано... https://www.garant.ru/products/ipo/prime/doc/12086549/
Участник оффлайн! DimVik




 прочитанное сообщение 13.01.2021 06:47     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #7 множественное цитирование

Спасибо большое за ваше время и труд! Я наверное не совсем правильно выразился. Дело в том, что я умею выделять днк. Проблема только в том как определить наличие нужного количества ДНК после выделения, его концентрацию. Хватит ли его на дальнейшее исследование? Бывают такие пробы в которых исходно очень мало материала и Днк выделяется ничтожное количество. Самый эффективный способ спектрофотометрия, но такого оборудования нет. Я слышал что бывают методики когда для этих целей используют Real-Time. Но сам найти их не могу и вообще на сколько это возможно?
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 13.01.2021 07:50     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #8 множественное цитирование

Ну теоретически вы можете попробовать методики с использованием интеркалирующих красителей типа sybr green. У меня конкретной методики нет, но думаю, что найти их можно.

Всего благодарностей: 2Поблагодарили (2): -Ъ-, semi
Участник оффлайн! vb
Постоянный участник



 прочитанное сообщение 13.01.2021 07:50     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #9 множественное цитирование

Чувствительность только будет не очень.
Участник оффлайн! DimVik




 прочитанное сообщение 13.01.2021 12:06     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #10 множественное цитирование

Спасибо большое. Про то что можно использовать Sybr green я уже слышал. Но так найти пока ничего не смог. Но как говорится .. стучите и вам откроется.. Еще раз спасибо.
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 13.01.2021 15:16     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #11 множественное цитирование

Если для КРС (крупного рогатого скота, т.е. Bos taurus), и проверять только выделение ДНК, то можно использовать Real-time PCR с универсальным красителем типа EvaGreen. Праймеры подойдут любые. Например, на ген CSN2 (casein beta). Я их рассчитывал для определения мутации A2, но для неё нужена ещё парочка зондов. С универсальным красителем будет дешевле.

Ампликон - 118N:

Forward: TCCACCCCTTTGCCCAGACACA 22N 66º

Reverse: AGGAAAGGCGGCACCACCACA 21N 67º

Сообщение было отредактировано genseq - 13.01.2021 15:17
Участник оффлайн! -Ъ-
Постоянный участник
Москва



 прочитанное сообщение 13.01.2021 15:39     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #12 множественное цитирование

Ну тоже ничего... Но лучше на митохондриалку, а еще лучше на высококопийные повторы, которых несколько тысяч на геном. Вот тогда чувствительность будет на самом высоком уровне.
Участник оффлайн! Ash
Участник



 прочитанное сообщение 13.01.2021 16:07     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #13 множественное цитирование

Ну так-то да, но это надо праймеры подбирать-конструировать, а вон выше, уже готовый вариант.
Участник оффлайн! Vadim Sharov
Постоянный участник
Россия



 прочитанное сообщение 13.01.2021 20:29     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #14 множественное цитирование

У меня есть подсознательное подозрение, что дешевле купить спектрофотометр, чем затевать кухню с синтезом праймеров, да и полимераза с красителем не копейки.
Участник оффлайн! Ash
Участник



 прочитанное сообщение 14.01.2021 11:10     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #15 множественное цитирование

(Vadim Sharov @ 13.01.2021 18:29)
Ссылка на исходное сообщение  У меня есть подсознательное подозрение, что дешевле купить спектрофотометр, чем затевать кухню с синтезом праймеров, да и полимераза с красителем не копейки.


Да ну, два праймера минимальное количество тысячи полторы, полимераза не заоблачно стоит, как и SybrGreen.... для нужд автора хватит минимального количества надолго.
Участник оффлайн! DimVik




 прочитанное сообщение 14.01.2021 11:26     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #16 множественное цитирование

Вот это ДА!!! Прям и не знаю как таких замечательных и отзывчивых людей поблагодарить! ОГРОМНОЕ ВАМ СПАСИБО. Информация очень ценная ! До покупки спектрофотометра еще не менее года. А знать наличие ДНК даже без концентрации нужно. Гонять пустые пробы на сиквинс за пять тыс. км удовольствие так себе. Уважаемый genseq вообще осчастливил целый коллектив начинающих! Всем здоровья и творческих успехов!
Участник оффлайн! Ash
Участник



 прочитанное сообщение 14.01.2021 11:55     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #17 множественное цитирование

Э, а вопрос можно? Вы на какой сиквенс пробы Ваши отдавали и кому, если не секрет? Значит, праймеры какие-то были?
Участник оффлайн! DimVik




 прочитанное сообщение 14.01.2021 12:58     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #18 множественное цитирование

Праймеры? Да были, в коммерческом наборе Гордиз Cattle. По поводу сиквенса договорились с Белгородом.
Участник оффлайн! -Ъ-
Постоянный участник
Москва



 прочитанное сообщение 14.01.2021 13:38     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #19 множественное цитирование

(DimVik @ 14.01.2021 13:58)
Ссылка на исходное сообщение  Праймеры? Да были, в коммерческом наборе Гордиз Cattle. По поводу сиквенса договорились с Белгородом.

В STR идентификации конечно нужно знать сколько добавлять ДНК в реакционную пробирку (достаточно 1-10 нг для рутинных работ). Когда-то я выбирал эти самые STR праймеры для лошадей и КРС.
Значит, кроме реал-тайм ПЦР у Вас есть и капиллярник тоже, то бишь секвенатор?
Мой совет, пользуйтесь испытанным китом для выделения ДНК, который "не теряет ДНК" в процессе, они есть в продаже (не буду заниматься рекламой). Иногда можно и не выделять ДНК, а делать "директ ПЦР". А Белгород прямо васюки 21 века. eek.gif
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 16.01.2021 17:12     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #20 множественное цитирование

Кстати, о Белгороде. Не стоит их недооценивать:
https://www.bsu.edu.ru/bsu/science/news/det...D=123&ID=673076
Участник оффлайн! DimVik




 прочитанное сообщение 18.01.2021 08:33     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #21 множественное цитирование

(-Ъ- @ 14.01.2021 18:38)
Ссылка на исходное сообщение  В STR идентификации конечно нужно знать сколько добавлять ДНК в реакционную пробирку (достаточно 1-10 нг для рутинных работ). Когда-то я выбирал эти самые STR праймеры для лошадей и КРС.
Значит, кроме реал-тайм ПЦР у Вас есть и капиллярник тоже, то бишь секвенатор?
Мой совет, пользуйтесь испытанным китом для выделения ДНК, который "не теряет ДНК" в процессе, они есть в продаже (не буду заниматься рекламой). Иногда можно и не выделять ДНК, а делать "директ ПЦР". А Белгород прямо васюки 21 века. eek.gif

День добрый! Нет секвенатора нет. Есть только Real-Time. Наборы используем отечественные, качество устраивает, цена тоже. Проблема бывает в том что исходного материала для выделения очень мало и возникают сомнения достаточно для дальнейшей работы или нет? СПАСИБО умным людям теперь знаем как проверить, пока не купим спектрофотометр. Белгород топчик! Тепло, светло много домашнего винограда хорошие люди грамотные специалисты. Для работы есть все что надо. umnik.gif smile.gif
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 18.01.2021 12:38     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #22 множественное цитирование

Кстати, о праймерах. Если ставить Real-Time PCR с краcителями, то ампликоны лучше брать подлиннее. Вот пример "из закромов" для ампликона длиной 250N:

U8528 GCTCGCTTGATCTTGATTTTCAGTACGAATACA 33N 66°

L8743 CAGCTCACGTTCCCTATTAGTGGGTGAACA 30N 68°

Рассчитаны на ген 28S RNA (рибосомная РНК). Подбирал для контроля выделения ДНК/РНК в кошачьей тест-системе, но они идеально походят и для человека, и для коровы, и даже для нематод.
Участник оффлайн! Ash
Участник



 прочитанное сообщение 18.01.2021 13:45     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #23 множественное цитирование

(genseq @ 18.01.2021 10:38)
Ссылка на исходное сообщение  Кстати, о праймерах. Если ставить Real-Time PCR с краcителями, то ампликоны лучше брать подлиннее. Вот пример "из закромов" для ампликона длиной 250N:

U8528 GCTCGCTTGATCTTGATTTTCAGTACGAATACA 33N 66°

L8743 CAGCTCACGTTCCCTATTAGTGGGTGAACA 30N 68°

Рассчитаны на ген 28S RNA (рибосомная РНК). Подбирал для контроля выделения ДНК/РНК в  кошачьей тест-системе, но они идеально походят и для человека, и для коровы, и даже для нематод.


Главное, в таком случае, чтобы не законтаминировали человеческими образцами....
Участник оффлайн! -Ъ-
Постоянный участник
Москва



 прочитанное сообщение 18.01.2021 14:52     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #24 множественное цитирование

(genseq @ 18.01.2021 13:38)
Ссылка на исходное сообщение  Кстати, о праймерах. Если ставить Real-Time PCR с краcителями, то ампликоны лучше брать подлиннее.

Чем длиннее, тем интенсивнее светятся? no.gif Глубоко ошибаешься, маэстро!
Чем короче ампликон, тем эффективнее реакция, и даже на вдрыск порванной ДНК (РНК), так что не надо ля-ля. Иногда на порядки чувствительность выше!

Всего благодарностей: 1Поблагодарили (1): semi
Участник оффлайн! -Ъ-
Постоянный участник
Москва



 прочитанное сообщение 18.01.2021 14:58     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #25 множественное цитирование

(DimVik @ 18.01.2021 09:33)
Ссылка на исходное сообщение  День добрый! Нет секвенатора нет. Есть только Real-Time. Наборы используем отечественные, качество устраивает, цена тоже. Проблема бывает в том что исходного материала для выделения очень мало и возникают сомнения достаточно для дальнейшей работы или нет? СПАСИБО умным людям теперь знаем как проверить, пока не купим спектрофотометр. Белгород топчик! Тепло, светло много домашнего винограда хорошие люди грамотные специалисты. Для работы есть все что надо.  umnik.gif  smile.gif

СФ, нонадропы - это дорого. В последние годы все Qubit покупали, но и он сейчас смотрю подорожал https://alamed.ru/catalog/genomika/probopodgotovka/35536/
https://www.thermofisher.com/ru/ru/home/ind...ters/qubit.html

Сообщение было отредактировано -Ъ- - 18.01.2021 15:05
Участник оффлайн! DimVik




 прочитанное сообщение 19.01.2021 04:34     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #26 множественное цитирование

(genseq @ 18.01.2021 17:38)
Ссылка на исходное сообщение  Кстати, о праймерах. Если ставить Real-Time PCR с краcителями, то ампликоны лучше брать подлиннее. Вот пример "из закромов" для ампликона длиной 250N:

U8528 GCTCGCTTGATCTTGATTTTCAGTACGAATACA 33N 66°

L8743 CAGCTCACGTTCCCTATTAGTGGGTGAACA 30N 68°

Рассчитаны на ген 28S RNA (рибосомная РНК). Подбирал для контроля выделения ДНК/РНК в  кошачьей тест-системе, но они идеально походят и для человека, и для коровы, и даже для нематод.

День добрый! Щедро! СПАСИБО! Принято. Попробуем при первой возможности.
Участник оффлайн! DimVik




 прочитанное сообщение 19.01.2021 04:39     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #27 множественное цитирование

(-Ъ- @ 18.01.2021 19:58)
Ссылка на исходное сообщение  СФ, нонадропы - это дорого. В последние годы все Qubit покупали, но и он сейчас смотрю подорожал https://alamed.ru/catalog/genomika/probopodgotovka/35536/
https://www.thermofisher.com/ru/ru/home/ind...ters/qubit.html


Да рассматривали такой вариант. Но решили с калибровками и расходниками не заморачиваться. Сегодня на них одни цены, завтра другие. Деньгами на спектрофотометр обещали, но во второй половине года. Выбрали пока такой: https://www.helicon.ru/catalog/oborudovanie...nophotometer-n/. Дорого конечно.
Участник оффлайн! DimVik




 прочитанное сообщение 19.01.2021 04:52     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #28 множественное цитирование

[quote=-Ъ-,14.01.2021 18:38]Ссылка на исходное сообщение  В STR идентификации конечно нужно знать сколько добавлять ДНК в реакционную пробирку (достаточно 1-10 нг для рутинных работ). Когда-то я выбирал эти самые STR праймеры для лошадей и КРС.
По поводу праймеров для КРС и Лошадей! Вот это экстремально интересная информация. smile.gif Как воздух нужна. Изыскиваем в научных статьях. Но некоторые при проверке оказываются кривые. Да и уровень знаний пока что не позволяет разобраться в тонкостях. Особенно как к примеру 30 праймеров будут вести себя в одной пробе. У Гордиза получается конечно. И то рекомендует понижение скорости в протоколе.
Участник оффлайн! -Ъ-
Постоянный участник
Москва



 прочитанное сообщение 19.01.2021 11:55     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #29 множественное цитирование

[quote=DimVik,19.01.2021 05:52]Ссылка на исходное сообщение  [quote=-Ъ-,14.01.2021 18:38]Ссылка на исходное сообщение  В STR идентификации конечно нужно знать сколько добавлять ДНК в реакционную пробирку (достаточно 1-10 нг для рутинных работ). Когда-то я выбирал эти самые STR праймеры для лошадей и КРС.
По поводу праймеров для КРС и Лошадей! Вот это экстремально интересная информация. smile.gif Как воздух нужна. Изыскиваем в научных статьях. Но некоторые при проверке оказываются кривые. Да и уровень знаний пока что не позволяет разобраться в тонкостях. Особенно как к примеру 30 праймеров будут вести себя в одной пробе. У Гордиза получается конечно. И то рекомендует понижение скорости в протоколе.
[/quote]
Да ради бога, не жалко, пользуйтесь, сейчас все доступно! smile.gif https://strbase.nist.gov//cattleSTRs.htm
Это правда, что некоторые праймеры нужно корректировать yes.gif - у каждого своя кухня.
И все краски к ним могем сделать, также как и сайз стандарты и все прочее... Аллельный ладдер для крс, свиней, кошек, собак и крокодилов это слишком жирно. Хоть 25 пар праймеров в одной пробирке! Но umnik.gif никакого желания, так как все перепробовал, удовлетворился...вообщем не боги горшки обжигают.
А советы - пожалуйста.
Участник оффлайн! -Ъ-
Постоянный участник
Москва



 прочитанное сообщение 19.01.2021 11:58     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #30 множественное цитирование

(DimVik @ 19.01.2021 05:39)
Ссылка на исходное сообщение  Да рассматривали такой вариант. Но решили с  калибровками и расходниками не заморачиваться. Сегодня на них одни цены, завтра другие. Деньгами на спектрофотометр обещали, но во второй половине года. Выбрали пока такой: https://www.helicon.ru/catalog/oborudovanie...nophotometer-n/. Дорого конечно.

Купите агарозный минифорез, стандартную ДНК фага Лямбда с известной точной концентрацией и вперед и вверх, как говорит всегда мой друг Генсек. smile.gif
Участник оффлайн! DimVik




 прочитанное сообщение 19.01.2021 12:27     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #31 множественное цитирование

Идея хорошая и напрашивается сама собой. Но к сожалению под электрофорез нужна отдельная комната. Ее пока нет. Грязноватый процесс.
Участник оффлайн! DimVik




 прочитанное сообщение 19.01.2021 12:30     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #32 множественное цитирование

(-Ъ- @ 19.01.2021 16:55)
Ссылка на исходное сообщение  Да ради бога, не жалко, пользуйтесь, сейчас все доступно! smile.gif https://strbase.nist.gov//cattleSTRs.htm
Это правда, что некоторые праймеры нужно корректировать yes.gif - у каждого своя кухня.
И все краски к ним могем сделать, также как и сайз стандарты и все прочее... Аллельный ладдер для крс, свиней, кошек, собак и крокодилов это слишком жирно. Хоть 25 пар праймеров в одной пробирке! Но umnik.gif никакого желания, так как все перепробовал,  удовлетворился...вообщем не боги горшки обжигают.
А советы - пожалуйста.

Понятно! ОГРОМНОЕ спасибо за помощь и совет!
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 19.01.2021 20:08     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #33 множественное цитирование

(-Ъ- @ 18.01.2021 12:52)
Ссылка на исходное сообщение  Чем длиннее, тем интенсивнее светятся? no.gif Глубоко ошибаешься, маэстро!
Чем короче ампликон, тем эффективнее реакция, и даже на вдрыск порванной ДНК (РНК), так что не надо ля-ля. Иногда на порядки чувствительность выше!


Лично я в вопросах Real-Time PCR теоретик. А мой друг Ъ - практик. Так что лучше верить ему. Несмотря на то, что теоретически я "правее". С красителями (при равных количествах праймеров) длинные ампликоны (250N) должны светить примерно в два раза сильнее коротких (118N). Но это только теоретически. Практически - нужно проверять. Проверить постараюсь в феврале. Тем более, что мне тоже пора осваивать контроль качества выделения ДНК. Пытался задействовать для этого доктора наук, "съевшего собаку" на флуоресценции ДНК, но он недавно неожиданно умер. frown.gif
https://www.twirpx.com/file/2608426/

Сообщение было отредактировано genseq - 19.01.2021 20:13
Участник оффлайн! DimVik




 прочитанное сообщение 20.01.2021 05:09     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #34 множественное цитирование

(genseq @ 20.01.2021 01:08)
Ссылка на исходное сообщение  Лично я в вопросах Real-Time PCR теоретик. А мой друг Ъ - практик. Так что лучше верить ему. Несмотря на то, что теоретически я "правее". С красителями (при равных количествах праймеров) длинные ампликоны (250N) должны светить примерно в два раза сильнее коротких (118N).  Но это только теоретически. Практически - нужно проверять. Проверить постараюсь в феврале. Тем более, что мне тоже пора осваивать контроль качества выделения ДНК. Пытался задействовать для этого доктора наук, "съевшего собаку" на флуоресценции ДНК, но он недавно неожиданно умер.  frown.gif
https://www.twirpx.com/file/2608426/

Жаль конечно, только всему научишься и помирать приходится. wall.gif Совсем недавно начал заниматься этим направлением. Безумно увлекательно! Тут встал вопрос где заказывать синтез праймеров? Давали адрес в Новосибирске, но отзывы разные по ним. В Москве наверное постабильнее?
Участник оффлайн! semi
Постоянный участник
Москва



 прочитанное сообщение 24.01.2021 14:55     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #35 множественное цитирование

(Ash @ 18.01.2021 14:45)
Ссылка на исходное сообщение  Главное, в таком случае, чтобы не законтаминировали человеческими образцами....

Точно.
Если консервативные последовательности, то лучше все-таки митохондриальные, IMHO.
Есть небольшой опыт с праймерами на хромосомные консервативные рибосомные повторы, которые тянут всё - от птицы до человека. С ними всё время лезет сигнал в контроле выделения. Видимо, контаминированы наборы для выделения ДНК. С митохондриальными такого нет.

Сообщение было отредактировано semi - 24.01.2021 14:55
Участник оффлайн! semi
Постоянный участник
Москва



 прочитанное сообщение 24.01.2021 15:02     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #36 множественное цитирование

(DimVik @ 19.01.2021 13:27)
Ссылка на исходное сообщение  Идея хорошая и напрашивается сама собой. Но к сожалению под электрофорез нужна отдельная комната. Ее пока нет. Грязноватый процесс.

Если гонять на форезе выделенную геномную ДНК КРС, то риски минимальные. Это же не ампликоны или плазмиды.

Всего благодарностей: 1Поблагодарили (1): -Ъ-
Участник оффлайн! DimVik




 прочитанное сообщение 25.01.2021 04:19     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #37 множественное цитирование

(genseq @ 23.01.2021 14:06)
Ссылка на исходное сообщение  А молоком не интересуетесь?


Очень круто! Спасибо! cool.gif Но это больше на перспективу. Сейчас достоверность происхождения и генетические заболевания.
Участник оффлайн! DimVik




 прочитанное сообщение 25.01.2021 04:26     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #38 множественное цитирование

(semi @ 24.01.2021 20:02)
Ссылка на исходное сообщение  Если гонять на форезе выделенную геномную ДНК КРС, то риски минимальные. Это же  не ампликоны  или плазмиды.

Да форез выход конечно. И мы его запустим все равно. Но позже. Тем более, в помещении где его планируем сейчас крутим кровь для иммуногенетики.
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение Сообщение на английском  26.01.2021 19:23     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #39 множественное цитирование

shuffle.gif
Участник оффлайн! watchesbiz
Постоянный участник



 прочитанное сообщение Сообщение на английском  28.09.2021 05:49     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #40 множественное цитирование

https://archives.profsurv.com/forum/Profess...ert/-67881.aspx
https://atlanta.bubblelife.com/community/an...ex_Watch_Online
https://gumroad.com/rolexrelicawatches/p/di...replica-watches
https://onmogul.com/stories/guide-on-how-to...ex-watch-online
https://list.ly/i/5704105
https://www.behance.net/gallery/114237003/Replica-Rolex
https://www.mlbdailydish.com/users/Replicarolexwatches
http://replicawatches24.simplesite.com/
https://watcheshutuk.cabanova.com/
https://www.pinterest.com/watcheshutuk/_saved/
https://www.linkedin.com/pulse/guide-how-pu...online-hei-bai/
https://justpaste.it/8t11q
https://padlet.com/watcheshutuk/in2opwnfmnmclce8
https://www.allforxi.com/users/Replicarolexwatches
https://profile.hatena.ne.jp/Rolexrelicawatches/profile

*




Кнопка "Транслит" перекодирует
текст из транслита в кирилицу.
Правила перекодировки здесь;
текст в квадратных скобках'[]'
не преобразуется.
Имя:

 преобразовывать смайлики · показать смайлики
Назначение кнопок:

   Поблагодарить автора сообщения — поблагодарить автора
   Удалить сообщение — удалить
   Редактировать сообщение — редактировать
   Поместить сообщение в колонку новостей — поместить в колонку новостей
   Цитировать — цитировать сообщение
   не входит в цитирование/входит в цитирование — цитировать несколько
   Отметить СПАМ-сообщение — обозначить спам
   Сообщение для модератора — связь с модератором
   Участник онлайн!/Участник оффлайн! — автор онлайн/оффлайн
   Фотография — фотография автора

   - остальные обозначения -
 
   *
« Предыдущая тема · Молекулярная и клеточная биология · Следующая тема »
Быстрый ответДобавить сообщение в темуСоздать новую тему

Rambler   molbiol.ru - методы, информация и программы для молекулярных биологов              

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Ваш форум  ·  redactor@molbiol.ru  ·  реклама  ·  Дата и время: 22.10.21 01:09
Bridged By IpbWiki: Integration Of Invision Power Board and MediaWiki © GlobalSoft