Rambler's Top100
Лёгкая версия форума* Виртуальная клавиатура  English  
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы
Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда | Междисциплинарный биологический онлайн-журналZbio-wiki

NG SEQUENCING · ЖИЗНЬ РАСТЕНИЙ · БИОХИМИЯ · ГОРОДСКИЕ КОМАРЫ · А.А.ЛЮБИЩЕВ · ЗООМУЗЕЙ


Темы за 24 часа  [ Вход* | Регистрация* ]  
   



Форум: 
 

Щёлкните, чтобы внести в Избранные Темы* Расчёты и преобразования -- comments to a permanent page of the site --
Тема связана с: Расчёты
Операции: Хочу стать куратором* · Подписаться на тему* · Отправить страницу по e-mail · Версия для печати*
Внешний вид:* Схема · [ Стандартный ] · +Перв.сообщ.


 
Добавить сообщение в темуСоздать новую темуСоздать голосование
Участник оффлайн! Forum robot
Постоянный участник
на сервере в Москве



 прочитанное сообщение 30.10.2006 13:11     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #1 множественное цитирование

Комментарии к постоянной странице сайта: Расчёты и преобразования

Программы, облегчающие биологической или химические лабораторные расчёты. Конверсия единиц измерения. Операции с нуклеотидной последовательностью: перевод в комплементарную, представление в виде двухцепочечной, трансляция, поиск редких кодонов. Расчёт параметров PCR. Спектрофотометрические измерения. Пересчёт скорости вращения в ускорение. Вычисление времени роста бактерий. Конверсия: масса - моли. Пересчёт молярного количества в молярную концентрацию.
Участник оффлайн! pilgrim

Германия



 прочитанное сообщение 30.10.2006 13:31     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес  ICQ
Цитировать Поместить сообщение в колонку новостей  URL #2 множественное цитирование

Предлагаю пользователям molbiol на рассмотрение созданную мною утилиту для рассчета параметров олигонуклеотидов.
Утилиту можно найти здесь - OligoCalculator v1.0.

Привествуются комментарии и замечания по улучшению утилиты.
Гость
IP-штамп: frCJsU5Jrwpcs
гость



 прочитанное сообщение Сообщение на английском  22.02.2008 08:58     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #3 множественное цитирование

>gi|22538412|ref|NM_148899.1| Homo sapiens forkhead box P2 (FOXP2), transcript variant 3, mRNA
AGTGAGCTAGCTTCTGAGTTTTCCCTTCTTTTTATACTGTTTTCTGTGCTGGCTTTTTTGAATCTTCCTA
ATTTTTCATCTCTTTAACAAACTCCTATGAAGTTGAAACCGGGAAGTTTGCTCTAACATTTCCAGAGAAG
GTATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATG
AGCACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACCAGCTCTGAAG
TAAGCACAGTAGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCAGCAAGACAACTTCTTTTACA
GCAGCAAACAAGTGGATTGAAATCTCCTAAGAGCAGTGATAAACAGAGACCACTGCAGCAGCCATGAGAC
AGACTTGTGGTTCTTCAACAGCTGTGCAGAGCAGAGACGTAAATTTAAGGTGTGCCTGTGTCAGTGGCCA
TGATGACTCCCCAGGTGATCACCCCTCAGCAAATGCAGCAGATCCTTCAGCAACAAGTCCTGTCTCCTCA
GCAGCTACAAGCCCTTCTCCAACAACAGCAGGCTGTCATGCTGCAGCAGCAACAACTACAAGAGTTTTAC
AAGAAACAGCAAGAGCAGTTACATCTTCAGCTTTTGCAGCAGCAGCAGCAACAGCAGCAGCAGCAACAAC
AGCAGCAACAACAGCAGCAGCAACAACAACAACAACAGCAGCAACAACAGCAGCAGCAGCAGCAACAGCA
GCAGCAGCAGCAACAGCATCCTGGAAAGCAAGCGAAAGAGCAGCAGCAGCAGCAGCAGCAGCAACAGCAA
TTGGCAGCCCAGCAGCTTGTCTTCCAGCAGCAGCTTCTCCAGATGCAACAACTCCAGCAGCAGCAGCATC
TGCTCAGCCTTCAGCGTCAGGGACTCATCTCCATTCCACCTGGCCAGGCAGCACTTCCTGTCCAATCGCT
GCCTCAAGCTGGCTTAAGTCCTGCTGAGATTCAGCAGTTATGGAAAGAAGTGACTGGAGTTCACAGTATG
GAAGACAATGGCATTAAACATGGAGGGCTAGACCTCACTACTAACAATTCCTCCTCGACTACCTCCTCCA
ACACTTCCAAAGCATCACCACCAATAACTCATCATTCCATAGTGAATGGACAGTCTTCAGTTCTAAGTGC
AAGACGAGACAGCTCGTCACATGAGGAGACTGGGGCCTCTCACACTCTCTATGGCCATGGAGTTTGCAAA
TGGCCAGGCTGTGAAAGCATTTGTGAAGATTTTGGACAGTTTTTAAAGCACCTTAACAATGAACACGCAT
TGGATGACCGAAGCACTGCTCAGTGTCGAGTGCAAATGCAGGTGGTGCAACAGTTAGAAATACAGCTTTC
TAAAGAACGCGAACGTCTTCAAGCAATGATGACCCACTTGCACATGCGACCCTCAGAGCCCAAACCATCT
CCCAAACCTCTAAATCTGGTGTCTAGTGTCACCATGTCGAAGAATATGTTGGAGACATCCCCACAGAGCT
TACCTCAAACCCCTACCACACCAACGGCCCCAGTCACCCCGATTACCCAGGGACCCTCAGTAATCACCCC
AGCCAGTGTGCCCAATGTGGGAGCCATACGAAGGCGACATTCAGACAAATACAACATTCCCATGTCATCA
GAAATTGCCCCAAACTATGAATTTTATAAAAATGCAGATGTCAGACCTCCATTTACTTATGCAACTCTCA
TAAGGCAGGCTATCATGGAGTCATCTGACAGGCAGTTAACACTTAATGAAATTTACAGCTGGTTTACACG
GACATTTGCTTACTTCAGGCGTAATGCAGCAACTTGGAAGAATGCAGTACGTCATAATCTTAGCCTGCAC
AAGTGTTTTGTTCGAGTAGAAAATGTTAAAGGAGCAGTATGGACTGTGGATGAAGTAGAATACCAGAAGC
GAAGGTCACAAAAGATAACAGGAAGTCCAACCTTAGTAAAAAATATACCTACCAGTTTAGGCTATGGAGC
AGCTCTTAATGCCAGTTTGCAGGCTGCCTTGGCAGAGAGCAGTTTACCTTTGCTAAGTAATCCTGGACTG
ATAAATAATGCATCCAGTGGCCTACTGCAGGCCGTCCACGAAGACCTCAATGGTTCTCTGGATCACATTG
ACAGCAATGGAAACAGTAGTCCGGGCTGCTCACCTCAGCCGCACATACATTCAATCCACGTCAAGGAAGA
GCCAGTGATTGCAGAGGATGAAGACTGCCCAATGTCCTTAGTGACAACAGCTAATCACAGTCCAGAATTA
GAAGACGACAGAGAGATTGAAGAAGAGCCTTTATCTGAAGATCTGGAATGAGAACTGACTTGTGAAACCT
CAGCGTGAAGGGACATATCACTGACCTTCATAACCACTCCACAACCATGAATATTTGACAAATTTTTACT
GTGACTATTTATTAAGCATGGATAAAGGAGACAGCCCTAAAGGAACTTACTAAGCCAGCCCTTTGGGATT
CAGTACCAACAGGCA

>gi|57113920|ref|NM_001009020.1| Pan troglodytes forkhead box P2 (FOXP2), mRNA
TGAGCTAGCTTCTGAGTTTTCCCTTCTTTTTATACTGTTTTCTGCGCTGGCTTTTTTGAATCTTCCTAAT
TTTTCATCTCTTTAACAAACTCCTATGAAGTTGAAACCGGGAAGTTTGCTCTAACATTTCCAGAGAAGGT
ATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATGAG
CACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACCAGCTCTGAAGTA
AGCACAGTAGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCGGCAAGACAACTTCTTTTACAGC
AGCAAACAAGTGGATTGAAATCTCCTAAGAGCAGTGATAAACAGAGACCACTGCAGGTGCCTGTGTCAGT
GGCCATGATGACTCCCCAGGTGATCACCCCTCAGCAAATGCAGCAGATCCTTCAGCAACAAGTCCTGTCT
CCTCAGCAGCTCCAAGCCCTTCTCCAACAACAGCAGGCTGTCATGCTGCAGCAGCAACAACTACAAGAGT
TTTACAAGAAACAGCAAGAGCAGTTACATCTTCAGCTTTTGCAGCAGCAGCAGCAACAGCAGCAGCAGCA
ACAACAGCAGCAACAACAGCAGCAGCAACAACAACAACAGCAGCAGCAGCAACAACAGCAGCAGCAGCAG
CAACAGCAGCAGCAGCAGCAACAGCATCCTGGAAAGCAAGCGAAAGAGCAGCAGCAGCAGCAGCAGCAGC
AACAGCAATTGGCAGCCCAGCAGCTTGTCTTCCAGCAGCAGCTTCTCCAGATGCAACAACTCCAGCAGCA
GCAGCATCTGCTCAGCCTTCAGCGTCAGGGACTCATCTCCATTCCACCTGGCCAGGCAGCACTTCCTGTC
CAATCGCTGCCTCAAGCTGGCTTAAGTCCTGCTGAGATTCAGCAGTTATGGAAAGAAGTGACTGGAGTTC
ACAGTATGGAAGACAATGGCATTAAACATGGAGGGCTAGACCTCACTACTAACAATTCCTCCTCGACTAC
CTCCTCCACCACTTCCAAAGCGTCACCACCAATAACTCATCATTCCATCGTGAATGGACAGTCTTCAGTT
CTAAATGCAAGACGAGACAGCTCGTCACATGAGGAGACTGGGGCCTCTCACACTCTCTATGGCCATGGAG
TTTGCAAATGGCCAGGCTGTGAAAGCATTTGTGAAGATTTTGGACAGTTTTTAAAGCACCTTAACAATGA
ACACGCATTGGATGACCGAAGCACTGCTCAGTGTCGAGTGCAAATGCAGGTGGTGCAACAGTTAGAAATA
CAGCTTTCTAAAGAACGCGAACGTCTTCAAGCAATGATGACCCACTTGCACATGCGACCCTCAGAGCCCA
AACCATCTCCCAAACCTCTAAATCTGGTGTCTAGTGTCACCATGTCGAAGAATATGTTGGAGACATCCCC
ACAGAGCTTACCTCAAACCCCTACCACACCAACGGCCCCAGTCACCCCGATTACCCAGGGACCCTCAGTA
ATCACCCCAGCCAGTGTGCCCAATGTGGGAGCCATACGAAGGCGACATTCAGACAAATACAACATTCCCA
TGTCATCAGAAATTGCCCCAAACTATGAATTTTATAAAAATGCAGATGTCAGACCTCCATTTACTTATGC
AACTCTCATAAGGCAGGCTATCATGGAGTCATCTGACAGGCAGTTAACACTTAATGAAATTTACAGCTGG
TTTACACGGACATTTGCTTACTTCAGGCGTAATGCAGCAACTTGGAAGAATGCAGTACGTCATAATCTTA
GCCTGCACAAGTGTTTTGTTCGAGTAGAAAATGTTAAAGGAGCAGTATGGACTGTGGATGAAGTAGAATA
CCAGAAGCGAAGGTCACAAAAGATAACAGGAAGTCCAACCTTAGTAAAAAATATACCTACCAGTTTAGGC
TATGGAGCAGCTCTTAATGCCAGTTTGCAGGCTGCCTTGGCAGAGAGCAGTTTACCTTTGCTAAGTAATC
CTGGACTGATAAATAATGCATCCAGTGGCCTACTGCAGGCCGTCCACGAAGACCTCAATGGTTCTCTGGA
TCACATCGACAGCAATGGAAACAGTAGTCCGGGCTGCTCACCTCAGCCGCACATACATTCAATCCACGTC
AAGGAAGAGCCAGTGATTGCAGAGGATGAAGACTGCCCAATGTCCTTAGTGACAACAGCTAATCACAGTC
CAGAATTAGAAGACGACAGAGAGATTGAAGAAGAGCCTTTATCTGAAGATCTGGAATGAGAACTGACTTG
TGAAACCTCAGCGTGAAGGGACATATCACTGACCTTCATAACCACTCCACAACCATGAATATTTGACAAA
TTTTTACTGTGACTATTTATTAAGCATGGATAAAGGAGACAGCCCTAAAGGAACTTACTAAGCCAGCCCT
TTGGGATTCA
Гость
IP-штамп: frCJsU5Jrwpcs
гость



 прочитанное сообщение Сообщение на английском  22.02.2008 09:06     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #4 множественное цитирование

gi|22538412|ref|NM_148899.1| Homo sapiens forkhead box P2 (FOXP2), transcript variant 3, mRNA
AGTGAGCTAGCTTCTGAGTTTTCCCTTCTTTTTATACTGTTTTCTGTGCTGGCTTTTTTGAATCTTCCTA
ATTTTTCATCTCTTTAACAAACTCCTATGAAGTTGAAACCGGGAAGTTTGCTCTAACATTTCCAGAGAAG
GTATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATG
AGCACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACCAGCTCTGAAG
TAAGCACAGTAGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCAGCAAGACAACTTCTTTTACA
GCAGCAAACAAGTGGATTGAAATCTCCTAAGAGCAGTGATAAACAGAGACCACTGCAGCAGCCATGAGAC
AGACTTGTGGTTCTTCAACAGCTGTGCAGAGCAGAGACGTAAATTTAAGGTGTGCCTGTGTCAGTGGCCA
TGATGACTCCCCAGGTGATCACCCCTCAGCAAATGCAGCAGATCCTTCAGCAACAAGTCCTGTCTCCTCA
GCAGCTACAAGCCCTTCTCCAACAACAGCAGGCTGTCATGCTGCAGCAGCAACAACTACAAGAGTTTTAC
AAGAAACAGCAAGAGCAGTTACATCTTCAGCTTTTGCAGCAGCAGCAGCAACAGCAGCAGCAGCAACAAC

>gi|57113920|ref|NM_001009020.1| Pan troglodytes forkhead box P2 (FOXP2), mRNA
TGAGCTAGCTTCTGAGTTTTCCCTTCTTTTTATACTGTTTTCTGCGCTGGCTTTTTTGAATCTTCCTAAT
TTTTCATCTCTTTAACAAACTCCTATGAAGTTGAAACCGGGAAGTTTGCTCTAACATTTCCAGAGAAGGT
ATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATGAG
CACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACCAGCTCTGAAGTA
AGCACAGTAGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCGGCAAGACAACTTCTTTTACAGC
AGCAAACAAGTGGATTGAAATCTCCTAAGAGCAGTGATAAACAGAGACCACTGCAGGTGCCTGTGTCAGT
GGCCATGATGACTCCCCAGGTGATCACCCCTCAGCAAATGCAGCAGATCCTTCAGCAACAAGTCCTGTCT
CCTCAGCAGCTCCAAGCCCTTCTCCAACAACAGCAGGCTGTCATGCTGCAGCAGCAACAACTACAAGAGT
TTTACAAGAAACAGCAAGAGCAGTTACATCTTCAGCTTTTGCAGCAGCAGCAGCAACAGCAGCAGCAGCA
ACAACAGCAGCAACAACAGCAGCAGCAACAACAACAACAGCAGCAGCAGCAACAACAGCAGCAGCAGCAG
CAACAGCAGCAGCAGCAGCAACAGCATCCTGGAAAGCAAGCGAAAGAGCAGCAGCAGCAGCAGCAGCAGC
AACAGCAATTGGCAGCCCAGCAGCTTGTCTTCCAGCAGCAGCTTCTCCAGATGCAACAACTCCAGCAGCA
GCAGCATCTGCTCAGCCTTCAGCGTCAGGGACTCATCTCCATTCCACCTGGCCAGGCAGCACTTCCTGTC
CAATCGCTGCCTCAAGCTGGCTTAAGTCCTGCTGAGATTCAGCAGTTATGGAAAGAAGTGACTGGAGTTC
ACAGTATGGAAGACAATGGCATTAAACATGGAGGGCTAGACCTCACTACTAACAATTCCTCCTCGACTAC
CTCCTCCACCACTTCCAAAGCGTCACCACCAATAACTCATCATTCCATCGTGAATGGACAGTCTTCAGTT
CTAAATGCAAGACGAGACAGCTCGTCACATGAGGAGACTGGGGCCTCTCACACTCTCTATGGCCATGGAG
TTTGCAAATGGCCAGGCTGTGAAAGCATTTGTGAAGATTTTGGACAGTTTTTAAAGCACCTTAACAATGA
Участник оффлайн! Дядя ФАКСер
Постоянный участник
Nothern Maccaronia, Ticinum



 прочитанное сообщение 18.09.2008 20:19     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail  ICQ
Цитировать Поместить сообщение в колонку новостей  URL #5 множественное цитирование

(ДЕЖУРНЫЙ ПО КОСМОСУ @ 18.09.2008 08:01)
Ссылка на исходное сообщение  Возможно ли с помощью хим. раекции некоторых соединений создать в капсуле огромное (милионное)давление при малых затратах вещества

"Гранату в рот- и выдернуть чеку" smile.gif
Участник оффлайн! Miss Marple
Участник
Москва vs. Европа



 прочитанное сообщение 23.02.2011 16:28     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #6 множественное цитирование

Уважаемые,
есть ли у кого-нибудь калькулятор еффективности ФРЕТ? Например, при известном изменении расстояния между парой донор/акцептор (и известном Фёрстр-радиусе)? А также "наоборот": вычисление расстояния при известной эффективности ФРЕТ?
Участник оффлайн! chivalry




 прочитанное сообщение Сообщение на английском  16.11.2011 14:37     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #7 множественное цитирование

http://translate.google.ru/translate?hl=ru...ochemistry/fret
Guest
IP-штамп: frxGOYQklo76Y
гость



 прочитанное сообщение 15.02.2017 05:18     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #8 множественное цитирование

Еще один неплохой сайт для онлайн расчетов, симуляций, сравнения списков генов и т.д.:

http://www.molbiotools.com/index.html

*




Кнопка "Транслит" перекодирует
текст из транслита в кирилицу.
Правила перекодировки здесь;
текст в квадратных скобках'[]'
не преобразуется.
Имя:

 преобразовывать смайлики · показать смайлики
Назначение кнопок:

   Поблагодарить автора сообщения — поблагодарить автора
   Удалить сообщение — удалить
   Редактировать сообщение — редактировать
   Поместить сообщение в колонку новостей — поместить в колонку новостей
   Цитировать — цитировать сообщение
   не входит в цитирование/входит в цитирование — цитировать несколько
   Отметить СПАМ-сообщение — обозначить спам
   Сообщение для модератора — связь с модератором
   Участник онлайн!/Участник оффлайн! — автор онлайн/оффлайн
   Фотография — фотография автора

   - остальные обозначения -
 
   *
« Предыдущая тема · Биофизика и матметоды в биологии · Следующая тема »
Быстрый ответДобавить сообщение в темуСоздать новую тему

Rambler   molbiol.ru - методы, информация и программы для молекулярных биологов              

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Ваш форум  ·  redactor@molbiol.ru  ·  реклама  ·  Дата и время: 21.10.17 06:23
Bridged By IpbWiki: Integration Of Invision Power Board and MediaWiki © GlobalSoft