Rambler's Top100
Лёгкая версия форума* Виртуальная клавиатура  English  
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы
Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда | Междисциплинарный биологический онлайн-журналZbio-wiki

NG SEQUENCING · ЖИЗНЬ РАСТЕНИЙ · БИОХИМИЯ · ГОРОДСКИЕ КОМАРЫ · А.А.ЛЮБИЩЕВ · ЗООМУЗЕЙ


Темы за 24 часа  [ Вход* | Регистрация* ]  
   



Форум: 
 

Щёлкните, чтобы внести в Избранные Темы* ПЦР и проблемы
ИнтерЛабСервис - передовые технологии молекулярной диагностики
Операции: Хочу стать куратором* · Подписаться на тему* · Отправить страницу по e-mail · Версия для печати*
Внешний вид:* Схема · [ Стандартный ] · +Перв.сообщ.


 
Добавить сообщение в темуСоздать новую темуСоздать голосование
Участник оффлайн! Аннушка90




 прочитанное сообщение 27.10.2008 20:41     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #1 множественное цитирование

Делаю реакцию со специфическими праймерами (в бласте нигде не отжигаются). Целевой фрагмент в 1500 букв не выходит, а получается что-то странное, в 300 букв. Ну мы это клонировали, сиквенс сделали - какая-то колбаса, ни на что конкретное не похоже.

Сделали праймеры дальше от тех что были раньше (и слева и справа), тоже колбаса (та же самая или нет - черт знает, еще не определили). Отжиг повысили до 62 градусов - фрагмент этот низкомолекулярный ярче и ярче, блин.

В чем может быть дело?

ЗЫ ПЦР с геномки, контроль без ДНК реакция не идет.

Сообщение было отредактировано Аннушка90 - 27.10.2008 20:44
Участник оффлайн! chatter
Участник



 прочитанное сообщение 27.10.2008 21:41     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #2 множественное цитирование

(Аннушка90 @ 27.10.2008 20:41)
Ссылка на исходное сообщение  Делаю реакцию со специфическими праймерами (в бласте нигде не отжигаются). Целевой фрагмент в 1500 букв не выходит, а получается что-то странное, в 300 букв. Ну мы это клонировали, сиквенс сделали - какая-то колбаса, ни на что конкретное не похоже.

Сделали праймеры дальше от тех что были раньше (и слева и справа), тоже колбаса (та же самая или нет - черт знает, еще не определили). Отжиг повысили до 62 градусов - фрагмент этот низкомолекулярный ярче и ярче, блин.

В чем может быть дело?

ЗЫ ПЦР с геномки, контроль без ДНК реакция не идет.

Ну вы маньяки, всякую грязь клонировать и секвенировать. wall.gif
Чего с температурой так осторожно, "аж" до 62? Мне тут когда-то присоветовали тачдаун, пару циклов отжиг 72, пару циклов 70, и так далее снижать до 60, на которых дожечь оставшиеся циклы. Знаете, помогло. До сих пор так работаю, если какие-то сомнения есть, никогда не подводило.
Ъ
IP-штамп: frNwv0U1khjS.
гость



 прочитанное сообщение 27.10.2008 22:09     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #3 множественное цитирование

Праймеры в студию! А также остальную информацию (сотав ПЦР микса, фермент, программа, циклер....).
Аннушка, мне понравились Ваши термины:

-в бласте нигде не отжигаются, confused.gif
-что-то странное, в 300 букв, confused.gif
-сиквенс сделали - какая-то колбаса, confused.gif
-целевой фрагмент в 1500 букв confused.gif
lol.gif frown.gif weep.gif
Yuri K
IP-штамп: frbSxBL61s/9I
гость



 прочитанное сообщение Сообщение на английском  28.10.2008 00:23     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #4 множественное цитирование

My guess is, your system selects against the longer product that you want. I. e., your PCR starts OK but then some mispriming event results in a by-product that has an advantage of being short.
Участник оффлайн! chatter
Участник



 прочитанное сообщение 28.10.2008 00:44     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #5 множественное цитирование

Навеяло

Челябинские молекулярные биологи настолько суровы, что клонируют все бэнды из геля, включая праймер клауд.

Сообщение было отредактировано chatter - 28.10.2008 00:46
guest: Аннушка
IP-штамп: frSrA/q9KZ6P2
гость



 прочитанное сообщение 28.10.2008 01:28     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #6 множественное цитирование

Поясню для тех, кто не понял.

-в бласте нигде не отжигаются,


На известные геномные последовательности не липнут.

-что-то странное, в 300 букв, 


Фрагмент в 300 букв. Что неясно?

-сиквенс сделали - какая-то колбаса, 


Колбаса и есть. Ошметки непонятной природы и назначения. Отжигается в бласте с крайне низкой гомологией на все что угодно от трипаносомы до human

-целевой фрагмент в 1500 букв


Предсказан в 1500 на основании сравнений по базе, а на самом деле мы не знаем, поэтому и клонировали то что вылезает.

Праймеры в студию!


А толку? Они без вторичных структур и не жгутся друг на друга. А по базам вы их не найдете. Программа с повторением циклов 94(15с)-62(30с)-72(30с), первым циклом плавление 5 минут, в конце элонгация тоже5.

Хочется заслышать опыт, у кого было нечто подобное и как от этого избавлялись? Просто очевидно, что тут не состав пцр-смеси играет роль, а либо косяк с залипанием праймеров не в то место, либо с температурой, либо и то и другое.
guest: Аннушка
IP-штамп: frSrA/q9KZ6P2
гость



 прочитанное сообщение 28.10.2008 01:31     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #7 множественное цитирование

На известные геномные последовательности не липнут. Т.е. липнут на то что известно нам, но не опубликовано.
guest: Аннушка
IP-штамп: frSrA/q9KZ6P2
гость



 прочитанное сообщение 28.10.2008 01:34     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #8 множественное цитирование

Чего с температурой так осторожно, "аж" до 62? Мне тут когда-то присоветовали тачдаун, пару циклов отжиг 72, пару циклов 70, и так далее снижать до 60, на которых дожечь оставшиеся циклы.


Ну, это было бы интересно, но приборчик наш так не умеет. "Терцик" российский.
Yuri K
IP-штамп: frbSxBL61s/9I
гость



 прочитанное сообщение 28.10.2008 01:58     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #9 множественное цитирование

(guest: Аннушка @ 28.10.2008 00:34)
Ссылка на исходное сообщение  Ну, это было бы интересно, но приборчик наш так не умеет. "Терцик" российский.

Touchdown PCR is the last resort of a loser.
Участник оффлайн! error
Постоянный участник
192.168.0.1



 прочитанное сообщение 28.10.2008 02:44     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #10 множественное цитирование

Хот старт попробуйте shuffle.gif
Щаз закидают помидорами, но если нет нормального фермента, можно все замесить в пробирках под маслом без полимеразы, запустить программу, а когда смесь прогреется до 95С/2 мин, добавить так (только пробирки из блока не вынимайте).
Plan B: Invitrogen AccuPrime
Участник оффлайн! chatter
Участник



 прочитанное сообщение Сообщение на английском  28.10.2008 03:00     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #11 множественное цитирование

(Yuri K @ 28.10.2008 01:58)
Ссылка на исходное сообщение  Touchdown PCR is the last resort of a loser.

I would prefer to be a loser with clones than a winner with a ... winner.
Участник оффлайн! chatter
Участник



 прочитанное сообщение 28.10.2008 03:03     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #12 множественное цитирование

(guest: Аннушка @ 28.10.2008 01:34)
Ссылка на исходное сообщение  Ну, это было бы интересно, но приборчик наш так не умеет. "Терцик" российский.

Ну тогда напишите ему 5 программ и запускайте их по мере прохождения.
Что у вас там за амплификатор? Водяная грелка с механическим таймером, что-ли?
Участник оффлайн! chatter
Участник



 прочитанное сообщение 28.10.2008 03:05     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #13 множественное цитирование

(error @ 28.10.2008 02:44)
Ссылка на исходное сообщение  Хот старт попробуйте shuffle.gif
Щаз закидают помидорами, но если нет нормального фермента, можно все замесить в пробирках под маслом без полимеразы, запустить программу, а когда смесь прогреется до 95С/2 мин, добавить так (только пробирки из блока не вынимайте).
Plan B: Invitrogen AccuPrime

Ну, раз уж переходим на дедовские методы, так давайте сразу парафиновую прокладку, а то вдруг их чудо техники после открытия крышки программу обнуляет. wall.gif
Guest
IP-штамп: fr45uHVgO7WZ2
гость



 прочитанное сообщение 28.10.2008 11:23     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #14 множественное цитирование

(chatter @ 28.10.2008 02:03)
Ссылка на исходное сообщение  Ну тогда напишите ему 5 программ и запускайте их по мере прохождения.
Что у вас там за амплификатор? Водяная грелка с механическим таймером, что-ли?


Терцик - это четыре комфорки на 10 пробирок 0.5 под маслом .
http://www.dna-technology.ru/catalog/ob_tercik2.shtml
Guest
IP-штамп: fr45uHVgO7WZ2
гость



 прочитанное сообщение 28.10.2008 11:31     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #15 множественное цитирование

(guest: Аннушка @ 28.10.2008 00:34)
Ссылка на исходное сообщение  Ну, это было бы интересно, но приборчик наш так не умеет. "Терцик" российский.


а вы уверены , что ваш приборчик держит те температуры смеси , которые
показывает ?
kb
IP-штамп: frGqyYT8IU7LU
гость



 прочитанное сообщение 28.10.2008 14:51     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #16 множественное цитирование

Попробуйте hot-start, и можно добавить в реакционную смесь бетаин до 1,5 - 2 М
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 28.10.2008 15:34     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #17 множественное цитирование

Я бы ещё посмотрел последовательность на DotPlot. На ней хорошо видны тандемные повторы. Если их много, то может получиться именно та картинка, которая Вам не нравится.
Ъ
IP-штамп: frNwv0U1khjS.
гость



 прочитанное сообщение 28.10.2008 16:15     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #18 множественное цитирование

Я думаю, это тот случай, когда выбраны корявые праймеры с нестабильными 3- концами (GC-богатые 3-концы). Вылезла неспецифика в виде одного бенда, а могло быть два-три или. В таких случаях говорят: горбатого исправит только... frown.gif
Минимальную информацию для участников, желающих помочь - праймеры с студию!, а все остальные советы - после umnik.gif .
Участник оффлайн! AleksandraL




 прочитанное сообщение 29.10.2008 09:00     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #19 множественное цитирование

А я бы еще время элонгации увеличить попробовала, 30 секунд для 1.5 kb может быть маловато, а вот для неспецифики - в самый раз...
Guest
IP-штамп: fr45uHVgO7WZ2
гость



 прочитанное сообщение 29.10.2008 11:37     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #20 множественное цитирование

(guest: Аннушка @ 28.10.2008 00:34)
Ссылка на исходное сообщение  Ну, это было бы интересно, но приборчик наш так не умеет. "Терцик" российский.


Afalina
Участник




прочитанное сообщение 14.03.2003 12:37 Сообщение для модератора Личное письмо Отправить e-mail
Цитировать Поместить сообщение в колонку новостей URL #24 множественное цитирование
На Терцике (у нас несколько МС-2) часто не добирается температура плавления (особенно при полной загрузке ячеек). Это может создать некоторые проблемы при работе с GC-богатыми матрицами. Так что проверяйте режимы с термопарой - реальные температуры могут отличаться даже при точной регуляции.
guest: Аннушка
IP-штамп: frNVjPT6S76SU
гость



 прочитанное сообщение 30.10.2008 18:04     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #21 множественное цитирование

Да, проймеры на конце GC богатые. Будем думать, короче. Пока что вытащили репцром высокие бэнды, посмотрим, что это такое.
guest: Аннушка
IP-штамп: frNVjPT6S76SU
гость



 прочитанное сообщение 30.10.2008 18:06     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #22 множественное цитирование

В смысле снизили температуру отжига, получили лестницу бэндов и вытащили верхние примерно того размера что нужно.
Ъ
IP-штамп: frNwv0U1khjS.
гость



 прочитанное сообщение 30.10.2008 20:13     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #23 множественное цитирование

(guest: Аннушка @ 30.10.2008 17:04)
Ссылка на исходное сообщение  Да, проймеры на конце GC богатые. Будем думать, короче. Пока что вытащили репцром высокие бэнды, посмотрим, что это такое.

Выбрали бы праймеры общими усилиями, своих мастермиксов подкинули на пробу. confused.gif Не стесняйтесь. wink.gif
Еще есть полимеразы с proofreeding (от 3-штрих до 5 экзо) активностью (Pfu DNA pol) для Лонг-ПЦР, для Ваших 1500 "букв". Нужно добавлять немного, около 1:15 или 1:20 к Так.полимеразе.
guest: Аннушка
IP-штамп: frNVjPT6S76SU
гость



 прочитанное сообщение 30.10.2008 20:58     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #24 множественное цитирование

форвард ttcaactgatcgtgaagttgcc
реверс TCAGCAACCCAAACACCATC - дает фрагмент в 300, при понижении t лестница.

еще есть реверс TAGTTTCTGCCTAACTGCCTCGG - чуть более дальний. Тоже работает на более низкой температуре (лестница на форезе), но при повышении работать перестает.
Ъ
IP-штамп: frNwv0U1khjS.
гость



 прочитанное сообщение 30.10.2008 22:25     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #25 множественное цитирование

(guest: Аннушка @ 30.10.2008 19:58)
Ссылка на исходное сообщение  форвард ttcaactgatcgtgaagttgcc
реверс TCAGCAACCCAAACACCATC - дает фрагмент в 300, при понижении t лестница.

еще есть реверс TAGTTTCTGCCTAACTGCCTCGG - чуть более дальний. Тоже работает на более низкой температуре (лестница на форезе), но при повышении работать перестает.

Если Вы уверены, что ожидаемый фрагмент около 1500 пн, а не 15 000, (все-таки матрица для выбора праймеров мРНК confused.gif, а ПЦР с геномки) попробуйте эти праймеры: 1) 5-ggc-att-caa-ctg-atc-gtg-aag-tt
2) 5-caa-ccc-aaa-cac-cat-cgt-act-a
Смещены немного, увидите, Т отж не менее 55 и не более 60 оС, обязателен горячий старт и 1 М бетаин. А лучше воспользоваться готовыми мастермиксами, где предусмотрено ВСЕ. smile.gif Будет все ОК.
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 30.10.2008 22:31     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #26 множественное цитирование

Salicornia brachiata
Salicornia bigelovii
Salicornia europaea -Солерос европейский

Растет на мокрых солончаках, у нас в Балаганском, Киренском районах, в Усть-Ордынском автономном округе, в Селенгинском, Мухор-Шибирском районах Бурятии, Борзинском и Нерчинском районах Читинской области. Цветет в конце июня-июле. Заготовляют траву солероса в период цветения.

Na+/H+ antiporter (NHX1)

Если не ошибаюсь, прамеры предназначены для клонирования гена, отвечающего за галофильность (солетолерантность?) растений.

Есть уверенность, что у данного "солероса" этот ген имеется в единственой копии? В процесе естественого отбора по способности расти на засолённых почвах ген мог многократно дуплицироваться и модифицироваться. Тогда Ваши праймеры могут амплифицировать не индивидуальный ампликон, а семейство родственных фрагментов ДНК. confused.gif
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 30.10.2008 22:41     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #27 множественное цитирование

Праймеры рассчитаны по последовательности мРНК rolleyes.gif . Последовательность ДНК, насколько я понял, пока неизвестна frown.gif . Если захватываются интроны, то шансов получить требуемый фрагмент с матрицы ДНК не очень много. Наверное, нужно выделять РНК и делать с неё кДНК. shuffle.gif
Участник оффлайн! error
Постоянный участник
192.168.0.1



 прочитанное сообщение 31.10.2008 01:16     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #28 множественное цитирование

ударим солексой по солеросу wink.gif
Участник оффлайн! error
Постоянный участник
192.168.0.1



 прочитанное сообщение 31.10.2008 01:45     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #29 множественное цитирование

(Аннушка90 @ 27.10.2008 13:41)
Ссылка на исходное сообщение  Делаю реакцию со специфическими праймерами (в бласте нигде не отжигаются).

Можно посмотреть тута, может, чего в голову придет.

Подвигайте праймеры туда-сюда.
Если нужна геномная посл-ть и есть желание потрахаться со старыми методами, попробуйте inverse PCR. Интересные вещи порой всплывают.

Сообщение было отредактировано error - 31.10.2008 01:50
guest: Аннушка
IP-штамп: frNVjPT6S76SU
гость



 прочитанное сообщение 31.10.2008 20:06     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #30 множественное цитирование

Если не ошибаюсь, прамеры предназначены для клонирования гена, отвечающего за галофильность (солетолерантность?) растений.


Нет, не для клонирования. Хотим полный сиквенс с геномки сделать.

В процесе естественого отбора по способности расти на засолённых почвах ген мог многократно дуплицироваться и модифицироваться. Тогда Ваши праймеры могут амплифицировать не индивидуальный ампликон, а семейство родственных фрагментов ДНК.


Да, может быть такое.

Последовательность ДНК, насколько я понял, пока неизвестна


Угу. Наша задача сделать ее известной.

Если захватываются интроны, то шансов получить требуемый фрагмент с матрицы ДНК не очень много.


Интроны захватываются, факт. Шансы довольно неплохие, т.к. с другими кусочками проблем не было (кроме случаев когда праймеры попадали на интрон/экзонную границу, но эти мы конструировали уже к известной геномке)
Участник оффлайн! Аннушка90




 прочитанное сообщение 14.11.2008 19:26     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #31 множественное цитирование

Заказали в "Бигле" новые праймеры, обещали до понедельника сделать, вот в понедельник и попробуем.
Ъ
IP-штамп: frNwv0U1khjS.
гость



 прочитанное сообщение 14.11.2008 20:04     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #32 множественное цитирование

(Аннушка90 @ 14.11.2008 18:26)
Ссылка на исходное сообщение  Заказали в "Бигле" новые праймеры, обещали до понедельника сделать, вот в понедельник и попробуем.

А как выглядят новые праймеры? Мой совет: настраивайтесь на худшее - предчувствие, что Вы тянете ~ 15 кб.
Кстати, Бигл - это сто такое?
Участник оффлайн! Аннушка90




 прочитанное сообщение 19.11.2008 22:50     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #33 множественное цитирование

Наконец развязалась с делами, появилась минутка написать.
Продукт ПОЛУЧИЛСЯ 1,5 кб!!!
Вырезала из геля и клонировала, к следующей неделе отсеквенируем. Очень расчитываю, что это целевой продукт. Последний кусочек мозаики остался.
Вот!
А "Бигль" это фирма такая, олиги в Питере делают очень быстро.
Участник оффлайн! error
Постоянный участник
192.168.0.1



 прочитанное сообщение 20.11.2008 04:45     Сообщение для модератора         Фотография  Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #34 множественное цитирование

(Ъ @ Nov 14 2008, 02:04 PM)
Ссылка на исходное сообщение  А как выглядят новые праймеры? Мой совет: настраивайтесь на худшее - предчувствие, что Вы тянете ~ 15 кб.
Кстати, Бигл - это сто такое?


Если бы все вопросы имели столь простые ответы...

http://en.wikipedia.org/wiki/Hms_beagle

HMS Beagle was a Cherokee class 10-gun brig-sloop of the Royal Navy, named after the beagle, a breed of dog. She was launched on 11 May 1820 from the Woolwich Dockyard on the River Thames, at a cost of £7,803. In July of that year she took part in a fleet review celebrating the coronation of King George IV of the United Kingdom in which she was the first ship to sail under the new London Bridge. After that there was no immediate need for Beagle so she was kept in reserve for five years and "lay in ordinary", moored afloat but without masts or rigging. She was then adapted as a survey barque and took part in three expeditions. On the second survey voyage the young naturalist Charles Darwin was on board, and his work would eventually make the Beagle one of the most famous ships in history.
guest: Диана
IP-штамп: fr6BL6bGbtf7M
гость



 прочитанное сообщение 23.11.2008 10:16     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #35 множественное цитирование

Здрвствуйте!я начинаю заниматся ПЦР и у меня возникла проблема с интерпретацией результатов на детекторе "Джин", точнее с программой!По какому принципу она работает? Есть ли какие-нибудь сайты, где можно узнать о данной прогамме?Помогите мне пожалуйста!мне очень нужна ваша помощь!Заранее огромное спасибо!
Участник оффлайн! ssve
Участник



 прочитанное сообщение 24.11.2008 11:14     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #36 множественное цитирование

Обращайтесь к производителю!
Guest
IP-штамп: fr45uHVgO7WZ2
гость



 прочитанное сообщение 24.11.2008 14:05     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #37 множественное цитирование

(ssve @ 24.11.2008 10:14)
Ссылка на исходное сообщение  Обращайтесь к производителю!


Про-Изводителю smile.gif
Участник оффлайн! NathalieK




 прочитанное сообщение 24.11.2008 16:53     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #38 множественное цитирование

(chatter @ 28.10.2008 00:44)
Ссылка на исходное сообщение  Навеяло

Челябинские молекулярные биологи настолько суровы, что клонируют все бэнды из геля, включая праймер...

жжёшь smile.gif
Участник оффлайн! Аннушка90




 прочитанное сообщение 25.11.2008 19:32     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #39 множественное цитирование

УРААА! ОтПЦРился и заклонировался целевой фрагмент! Сиквенс показал!
Ъ
IP-штамп: frNwv0U1khjS.
гость



 прочитанное сообщение 25.11.2008 20:33     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #40 множественное цитирование

(Аннушка90 @ 25.11.2008 18:32)
Ссылка на исходное сообщение  УРААА! ОтПЦРился и заклонировался целевой фрагмент! Сиквенс показал!

weep.gif wall.gif weep.gif wall.gif beer.gif beer.gif jump.gif jump.gif lol.gif lol.gif
Участник оффлайн! Аннушка90




 прочитанное сообщение 25.11.2008 23:37     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #41 множественное цитирование

Всем огромное спасибо за помощь и за поддержку! Особенно Ъ, error, genseq, chatter!
Guest
IP-штамп: frM1p/H99Ug/Q
гость



 прочитанное сообщение 25.11.2008 23:54     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #42 множественное цитирование

Аннушка, не проливайте масло!
Guest
IP-штамп: frGqyYT8IU7LU
гость



 прочитанное сообщение 26.11.2008 11:06     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #43 множественное цитирование

(Аннушка90 @ 25.11.2008 18:32)
Ссылка на исходное сообщение  УРААА! ОтПЦРился и заклонировался целевой фрагмент! Сиквенс показал!


Ну, скажите же теперь самое интересное, wink.gif у кого заказывали праймеры в первый раз?
Ъ
IP-штамп: frNwv0U1khjS.
гость



 прочитанное сообщение 26.11.2008 12:11     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #44 множественное цитирование

(Guest @ 25.11.2008 22:54)
Ссылка на исходное сообщение  Аннушка, не проливайте масло!

Уже поздно... tongue.gif

Я так понимаю, что Аннушка не пересинтезировала те проблемные праймеры, а вновь синтезировала, "сместила" вперед-
назад, вообщем доканала и получила нужный фрагмент. Секвенировала фрагмент для потверждения - это круто! umnik.gif
Участник оффлайн! Аннушка90




 прочитанное сообщение 26.11.2008 15:45     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #45 множественное цитирование

Да, двигала туда-сюда.
При секвенировании оказалось, что один из предыдущих праймеров "висел" с 3' конца на 3 нуклеотида (из-за интрона), ПЦР физически пройти не мог. Виноватых нет, ну или Матушка Природа виновата.

*




Кнопка "Транслит" перекодирует
текст из транслита в кирилицу.
Правила перекодировки здесь;
текст в квадратных скобках'[]'
не преобразуется.
Имя:

 преобразовывать смайлики · показать смайлики
Назначение кнопок:

   Поблагодарить автора сообщения — поблагодарить автора
   Удалить сообщение — удалить
   Редактировать сообщение — редактировать
   Поместить сообщение в колонку новостей — поместить в колонку новостей
   Цитировать — цитировать сообщение
   не входит в цитирование/входит в цитирование — цитировать несколько
   Отметить СПАМ-сообщение — обозначить спам
   Сообщение для модератора — связь с модератором
   Участник онлайн!/Участник оффлайн! — автор онлайн/оффлайн
   Фотография — фотография автора

   - остальные обозначения -
 
   *
« Предыдущая тема · Молекулярная и клеточная биология · Следующая тема »
Быстрый ответДобавить сообщение в темуСоздать новую тему

Rambler   molbiol.ru - методы, информация и программы для молекулярных биологов              

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Ваш форум  ·  redactor@molbiol.ru  ·  реклама  ·  Дата и время: 23.10.21 15:42
Bridged By IpbWiki: Integration Of Invision Power Board and MediaWiki © GlobalSoft