Rambler's Top100
Лёгкая версия форума* Виртуальная клавиатура  English  
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы
Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда | Междисциплинарный биологический онлайн-журналZbio-wiki

NG SEQUENCING · ЖИЗНЬ РАСТЕНИЙ · БИОХИМИЯ · ГОРОДСКИЕ КОМАРЫ · А.А.ЛЮБИЩЕВ · ЗООМУЗЕЙ


Темы за 24 часа  [ Вход* | Регистрация* ]  
   



Форум: 
 

Щёлкните, чтобы внести в Избранные Темы* ПЦР диагностика лимфомы Беркитта
ИнтерЛабСервис - передовые технологии молекулярной диагностики
Операции: Хочу стать куратором* · Подписаться на тему* · Отправить страницу по e-mail · Версия для печати*
Внешний вид:* Схема · [ Стандартный ] · +Перв.сообщ.


 
Добавить сообщение в темуСоздать новую темуСоздать голосование
Участник оффлайн! V.A.




 прочитанное сообщение 05.05.2011 15:30     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #1 множественное цитирование

Здравствуйте! Собираемся наладить в лаборатории диагностику МРД при лимфоме Беркитта методом ПЦР. Может кто-то уже разработал методику и немного в этом разбирается. Прошу откликнуться.
Пока мучаюсь с ПЦР длинных фрагментов, транслокация c-myc/Ig H. реакция вроде проходит, четко видны бенды контрольного гена (c-myc), а вот с транслокацией ничего не выходит: много неспецифических бендов, так что не понять где нужный. Подскажите что делать. (Праймеры брали из статьи)
Участник оффлайн! Noom
Постоянный участник



 прочитанное сообщение 07.05.2011 13:15     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #2 множественное цитирование

Праймеры проверьте бластом чему они еще кроме вашей мишени комплиментарны. Это обязательный пункт при работе с праймерами 'из статьи'.
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 07.05.2011 16:05     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #3 множественное цитирование

Можно посмотреть праймеры?
Дайте ссылку или последовательности.
Guest
IP-штамп: fr45uHVgO7WZ2
гость



 прочитанное сообщение 09.05.2011 18:54     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #4 множественное цитирование

(V.A. @ 05.05.2011 15:30)
Ссылка на исходное сообщение  Здравствуйте! Собираемся наладить в лаборатории диагностику МРД при лимфоме Беркитта методом ПЦР. Может кто-то уже разработал методику и немного в этом разбирается. Прошу откликнуться.
Пока мучаюсь с ПЦР длинных фрагментов, транслокация ц-мыц/Иг Х. реакция вроде проходит, четко видны бенды контрольного гена (ц-мыц), а вот с транслокацией ничего не выходит: много неспецифических бендов, так что не понять где нужный. Подскажите что делать. (Праймеры брали из статьи)


замучутесь все "транслокации беркутов мерють" frown.gif эта транслокация не единственная у беркутов и урядли поможет при диагностике frown.gif
Guest
IP-штамп: fr45uHVgO7WZ2
гость



 прочитанное сообщение Сообщение на английском  09.05.2011 19:03     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #5 множественное цитирование

http://www.ncbi.nlm.nih.gov/pmc/articles/P...one.0007089.pdf
Участник оффлайн! -Ъ-
Постоянный участник
Москва



 прочитанное сообщение 09.05.2011 22:32     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #6 множественное цитирование

(V.A. @ 05.05.2011 16:30)
Ссылка на исходное сообщение  Здравствуйте! Собираемся наладить в лаборатории диагностику МРД при лимфоме Беркитта методом ПЦР. Может кто-то уже разработал методику и немного в этом разбирается. Прошу откликнуться.
Пока мучаюсь с ПЦР длинных фрагментов, транслокация c-myc/Ig H. реакция вроде проходит, четко видны бенды контрольного гена (c-myc), а вот с транслокацией ничего не выходит: много неспецифических бендов, так что не понять где нужный. Подскажите что делать. (Праймеры брали из статьи)

Не очень понятно в чем будет заключаться "диагностика МРД при лимфоме Беркитта методом ПЦР"? confused.gif Поясните про "Методику". плз.
Guest
IP-штамп: fr45uHVgO7WZ2
гость



 прочитанное сообщение 10.05.2011 08:40     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #7 множественное цитирование

(-Ъ- @ 09.05.2011 22:32)
Ссылка на исходное сообщение  Не очень понятно в чем будет заключаться "диагностика МРД при лимфоме Беркитта методом ПЦР"? confused.gif Поясните про "Методику". плз.

http://bloodjournal.hematologylibrary.org/.../90/6/2456.long
Guest
IP-штамп: fr45uHVgO7WZ2
гость



 прочитанное сообщение Сообщение на английском  11.05.2011 10:30     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #8 множественное цитирование

Nature. 2011 Apr 21;472(7343):375-8. Epub 2011 Apr 3.
Genome-wide analysis reveals novel molecular features of mouse recombination hotspots.
Smagulova F, Gregoretti IV, Brick K, Khil P, Camerini-Otero RD, Petukhova GV.
Source

1] Uniformed Services University of the Health Sciences, Bethesda, Maryland 20814, USA [2].
Abstract

Meiotic recombination predominantly occurs at discrete genomic loci called recombination hotspots, but the features defining these areas are still largely unknown (reviewed in refs 1-5). To allow a comprehensive analysis of hotspot-associated DNA and chromatin characteristics, we developed a direct molecular approach for mapping meiotic DNA double-strand breaks that initiate recombination. Here we present the genome-wide distribution of recombination initiation sites in the mouse genome. Hotspot centres are mapped with approximately 200-nucleotide precision, which allows analysis of the fine structural details of the preferred recombination sites. We determine that hotspots share a centrally distributed consensus motif, possess a nucleotide skew that changes polarity at the centres of hotspots and have an intrinsic preference to be occupied by a nucleosome. Furthermore, we find that the vast majority of recombination initiation sites in mouse males are associated with testis-specific trimethylation of lysine 4 on histone H3 that is distinct from histone H3 lysine 4 trimethylation marks associated with transcription. The recombination map presented here has been derived from a homogeneous mouse population with a defined genetic background and therefore lends itself to extensive future experimental exploration. We note that the mapping technique developed here does not depend on the availability of genetic markers and hence can be easily adapted to other species with complex genomes. Our findings uncover several fundamental features of mammalian recombination hotspots and underline the power of the new recombination map for future studies of genetic recombination, genome stability and evolution.
Участник оффлайн! V.A.




 прочитанное сообщение 11.05.2011 11:48     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #9 множественное цитирование

Ссылка на статью
http://www.haematologica.org/cgi/reprint/89/7/818

Разрабатываем дианостику МРД у больных ЛБ пока с t(8;14).
В статье у них все хорошо получается, пыталась делать все по статье, но ПЦР вообще не идет. Пытаюсь подобрать другие условия. Увеличила температуру отжига до 75 С и время элонгации до 10 мин, вроде неспецифика ушла, но исчез и один из контрольных генов. confused.gif
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 11.05.2011 16:02     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #10 множественное цитирование

Спасибо за статью. Задачка оказалась высшего уровня сложности. Похоже, пока от первоисточников отступать не стоит. Можно, конечно, попытаться сделать праймеры получше (повысить специфичность 3'-концов, разобраться с возможными шпильками, увеличить Tm), но разбираться придётся долго, а жизнь коротка.
Участник оффлайн! RJ Dio
Постоянный участник



 прочитанное сообщение 11.05.2011 17:37     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #11 множественное цитирование

это как- повысить специфичность концов? В чем она измеряется и каковы критерии? Совет из серии бессмысленных. Надо просто перебором нескольких пар подобрать лучшую комбинацию- никто мудрее эмпирики ничего не придумал. Так и разрабатывают все диагностики- перелопачивают кучу дерьма и получают работающую систему. Конечно, не только в самих праймерах дело, много параметров, которые стоит оптимизировать. И наивно думать, что поболтав денек-другой в форуме, можно что-то получить
Кстати, отжиг на 75гр- нонсенс, если сама полимераза работает на 72! Выше 68 вообще нет смысла задирать, а формула стандартная перестает работать. Пробуйте иные структуры олигов

Всего благодарностей: 1Поблагодарили (1): ship
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 11.05.2011 18:51     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #12 множественное цитирование

(V.A. @ 11.05.2011 09:48)
Ссылка на исходное сообщение  Ссылка на статью
  http://www.haematologica.org/cgi/reprint/89/7/818

Разрабатываем дианостику МРД у больных ЛБ пока с t(8;14).
В статье у них все хорошо получается, пыталась делать все по статье, но ПЦР вообще не идет. Пытаюсь подобрать другие условия. Увеличила температуру отжига до 75 С и время элонгации до 10 мин, вроде неспецифика ушла, но исчез и один из контрольных генов.  confused.gif


Вот ещё пара ссылок. Правда, не на праймеры:

Сообщение было отредактировано genseq - 11.05.2011 18:52

Файл/ы:

скачать файл Review_Article.pdf
размер: 649.31к
кол-во скачиваний: 402



скачать файл Detection_of_minimal_residual_disease.pdf
размер: 571.76к
кол-во скачиваний: 1543


Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 11.05.2011 21:01     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #13 множественное цитирование

Люблю сложные задачки.

Обнаружил статью с анализом распределения точек разрыва в гене myc:
картинка: Myc.JPG
Судя по картинке, большинство используемых Вами праймеров захватывают много лишнего (829; 1611; 2410; 3250; 4458; 4885; 8151). Для большинства транслокаций можно подобрать 2...3 праймера, которые при любом раскладе будут давать ампликоны длиной меньше 1...2 т.п.о..

P.S.: спасибо Tom1 за оперативность. Он прислал статью почти сразу после моего запроса на Full text.

Сообщение было отредактировано genseq - 11.05.2011 21:04

Файл/ы:

скачать файл kulibin.pdf
размер: 287.64к
кол-во скачиваний: 440


Участник оффлайн! RJ Dio
Постоянный участник



 прочитанное сообщение 12.05.2011 10:05     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #14 множественное цитирование

да уж, праймеры дизайнить- не форезницы лепить! Все могем, едренть, как Леонардо наш, не побоюсь этого слова, Да Винчи- и велосипед с вертолетом изобретать. и картины писать, и наукой заниматься и еще бездну всего-всего. И секвенить, и диагностикумы делать, и задачки сложные тонким перышком в тетрадь. Это ведь наверняка далеко не все- и грибочки мариновать, и рыбку поудить, и в форуме помодерировать. А стихи, во- стихи не пишите? Помогу с изданием нетленки
Участник оффлайн! RJ Dio
Постоянный участник



 прочитанное сообщение 12.05.2011 10:06     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #15 множественное цитирование

а то потомки проклянут- гения пробакланили, не признали современники. Так ведь признали!
Участник оффлайн! -Ъ-
Постоянный участник
Москва



 прочитанное сообщение 12.05.2011 15:04     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #16 множественное цитирование

Что-то не очень смешно... Раньше был другой юмор у диджея... frown.gif
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение 13.05.2011 08:38     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #17 множественное цитирование

Вернёмся к теме.

Информация к размышлению:

При лимфомах рецидивы болезни после химиотерапии необходимо отслеживать на самых ранних стадиях, т.е. обнаруживать одиночные мутантные клетки на фоне большого количества нормальных. Это и есть MRD (minimal residual disease).
Онкогенные мутации чрезвычайно разнообразны и за всеми не уследить, но при особо злобной лимфоме Беркитта довольно часто их маркёрами могут служить транслокации, повреждающие ген myc в результате обмена плечей 8 и 14 хромосом - t(8;14).
Основной причиной транслокаций являются ошибки системы рекомбинации, обеспечивающей многообразие вариабельных участков тяжёлых цепей иммуноглобулиной. Чаще всего такая рекомбинация происходит в четырёх компактных локуса (условно - 01, 02, 03 и JH), но при незаконной рекомбинации "половинки" эти локусов могут стыковаться с другими хромосомами довольно произвольно. Если стыковка повреждает myc или какой-либо другой важный ген, и если одна из аллелей уже повреждена (имеется генетическая предрасположенность к онкологическим заболеваниям), то это может привести к развитию лимфомы.

Наиболее прогрессивный подход - секвенирование участка стыковки хромосом и подбор для каждого пациента индивидуальной пары праймеров. Менее прогрессивный, но более дешёвый - использование набора стандартных праймеров, у которых есть шанс захватить участок стыковки хромосом. Чем длиннее ампликоны, тем выше шансы, поэтому желательно использовать Long Distance PCR. Но добиться высокой специфичности LD PCR при высокой концентрации геномной ДНК очень сложно.

Возможное решение - уменьшить длину ампликонов и повысить специфичность праймеров. Это немного уменьшит шансы захвата точки рекомбинации хромосом, но лучше так, чем никак. Но можно и без жертв, если проверять больше ампликонов, но меньшей длины.

Если есть желание поиграться с не литературными праймерами, то могу подобрать.
Участник оффлайн! RJ Dio
Постоянный участник



 прочитанное сообщение 13.05.2011 21:53     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #18 множественное цитирование

много буков. И что? Без пол-литра...
Участник оффлайн! genseq
Постоянный участник



 прочитанное сообщение Сообщение на английском  14.05.2011 07:46     Сообщение для модератора         Личное письмо  Отправить e-mail  Web-адрес
Цитировать Поместить сообщение в колонку новостей  URL #19 множественное цитирование

1003 11 May 2011

DNA file: MYC.SEQ [10996]
>gi|11493193|emb|X00364.2| Homo sapiens MYC gene for c-myc proto-oncogene and

OPTIMAL ANNEALING TEMP.: 61.9°
Product length: 1003 bp; 59.0% GC
Tm(prod.-less stable primer): 21.0°
Primers Tm difference: 0.5°
Upper:1983 (26) ->-------
Lower:2962 (24) -------<-
3'-ends dG: U=-6.7 L=-6.4

╔═══════╤════════╤════════╤════════╤══════╗
║ Oligo │ Tm [°C]│ nmol/OD│ µg/OD'│ Mr ║
╠═══════╪════════╪════════╪════════╪══════╣
║ Upper │ 62.4│ 4.13│ 32.9│ 7961║
║ Lower │ 61.9│ 3.85│ 29.2│ 7598║
╚═════════════════════════════════════════╝





OPTIMAL ANNEALING TEMP.: 61.5°
Product length: 1557 bp; 57.0% GC
Tm(prod.-less stable primer): 20.0°
Primers Tm difference: 0.5°
Upper:1983 (26) ->-------
Lower:3515 (25) -------<-
3'-ends dG: U=-6.7 L=-6.1


╔═══════╤════════╤════════╤════════╤══════╗
║ Oligo │ Tm [°C]│ nmol/OD│ µg/OD'│ Mr ║
╠═══════╪════════╪════════╪════════╪══════╣
║ Upper │ 62.4│ 4.13│ 32.9│ 7961║
║ Lower │ 61.9│ 4.30│ 32.5│ 7565║
╚═════════════════════════════════════════╝




> UPPER PRIMER: Positive strand of MYC.SEQ, pos. 1983:
TCCGCCTGCGATGATTTATACTCACA

> LOWER PRIMER: Negative strand of MYC.SEQ, pos. 2962:
AGCGCAGGAATGGGAGAAAAGACA

> LOWER PRIMER: Negative strand of MYC.SEQ, pos. 3515:
GCCTACCCAACACCACGTCCTAACA

Сообщение было отредактировано genseq - 14.05.2011 07:50
Участник оффлайн! -Ъ-
Постоянный участник
Москва



 прочитанное сообщение 14.05.2011 15:48     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #20 множественное цитирование

(RJ Dio @ 12.05.2011 11:05)
Ссылка на исходное сообщение  да уж, праймеры дизайнить- не форезницы лепить! Все могем, едренть, как Леонардо наш, не побоюсь этого слова, Да Винчи- и велосипед с вертолетом изобретать. и картины писать, и наукой заниматься и еще бездну всего-всего. И секвенить, и диагностикумы делать, и задачки сложные тонким перышком в тетрадь. Это ведь наверняка далеко не все- и грибочки мариновать, и рыбку поудить, и в форуме помодерировать. А стихи, во- стихи не пишите? Помогу с изданием нетленки

Ты скоро автограф у Генсека будешь просить, так чта... tongue.gif

*




Кнопка "Транслит" перекодирует
текст из транслита в кирилицу.
Правила перекодировки здесь;
текст в квадратных скобках'[]'
не преобразуется.
Имя:

 преобразовывать смайлики · показать смайлики
Назначение кнопок:

   Поблагодарить автора сообщения — поблагодарить автора
   Удалить сообщение — удалить
   Редактировать сообщение — редактировать
   Поместить сообщение в колонку новостей — поместить в колонку новостей
   Цитировать — цитировать сообщение
   не входит в цитирование/входит в цитирование — цитировать несколько
   Отметить СПАМ-сообщение — обозначить спам
   Сообщение для модератора — связь с модератором
   Участник онлайн!/Участник оффлайн! — автор онлайн/оффлайн
   Фотография — фотография автора

   - остальные обозначения -
 
   *
« Предыдущая тема · Молекулярная и клеточная биология · Следующая тема »
Быстрый ответДобавить сообщение в темуСоздать новую тему

Rambler   molbiol.ru - методы, информация и программы для молекулярных биологов              

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Ваш форум  ·  redactor@molbiol.ru  ·  реклама  ·  Дата и время: 22.10.17 23:56
Bridged By IpbWiki: Integration Of Invision Power Board and MediaWiki © GlobalSoft