Rambler's Top100
Лёгкая версия форума* Виртуальная клавиатура  English  
Molbiol.ru | О проекте | Справочник | Методы | Растворы | Расчёты | Литература | Орг.вопросы
Web | Фирмы | Coffee break | Картинки | Работы и услуги | Биржа труда | Междисциплинарный биологический онлайн-журналZbio-wiki

NG SEQUENCING · ЖИЗНЬ РАСТЕНИЙ · БИОХИМИЯ · ГОРОДСКИЕ КОМАРЫ · А.А.ЛЮБИЩЕВ · ЗООМУЗЕЙ


Темы за 24 часа  [ Вход* | Регистрация* ]  
   



Форум: 
 

* Как проверить структуру белка? -- Помогите проверить структуру коллагена --
Операции: Хочу стать куратором* · Подписаться на тему* · Отправить страницу по e-mail · Версия для печати*
Внешний вид:* Схема · [ Стандартный ] · +Перв.сообщ.


Добавить сообщение в темуСоздать новую тему
Участник оффлайн! Student2012




 прочитанное сообщение 05.01.2012 00:33     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #1 множественное цитирование

user posted image
Наткнулся в инете на структуру коллагена.

user posted image
Автор заявляет, что эта модель сделана с точностью 1 пикометр.

user posted image

user posted image
Подробности: http://nanoworld88.narod.ru/data/268.htm

Как проверить структуру коллагена хотя бы с точностью до нанометра?

Сообщение было отредактировано Student2012 - 05.01.2012 00:38

  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 05.01.2012 01:54     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #2 множественное цитирование

Рентгеноструктурный анализ? =)

Сообщение было отредактировано Flyamer - 05.01.2012 01:55

  

  Белки -- статья в Википедии  
Участник оффлайн! Nastja
Постоянный участник
Новосибирск



 прочитанное сообщение 05.01.2012 06:39     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #3 множественное цитирование

Для начала надо перестать читать [ненаучную литературу] и начать читать научные статьи.

Сообщение было отредактировано NMR-guy - 05.01.2012 13:47

Всего благодарностей: 1Поблагодарили (1): Esya


  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 05.01.2012 07:52     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #4 множественное цитирование

(Nastja @ 05.01.2012 07:39)
Ссылка на исходное сообщение  Для начала надо перестать читать [ненаучную литературу] и начать читать научные статьи.

Это точно =)

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 05.01.2012 11:11     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #5 множественное цитирование

(Flyamer @ 05.01.2012 02:54)
Ссылка на исходное сообщение  Рентгеноструктурный анализ? =)


Коллаген относится к фибриллярным белкам, которые не кристаллизуются. А РСА (рентгено-структурный анализ) применим только к кристаллизующимся белкам.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 05.01.2012 11:21     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #6 множественное цитирование

(Nastja @ 05.01.2012 07:39)
Ссылка на исходное сообщение  Для начала надо перестать читать [ненаучную литературу] и начать читать научные статьи.


Благодарю за совет! А Вы не могли бы дать ссылку на научную статью, где опубликованы результаты исследования коллагена этого типа?

user posted image

user posted image

Мне удалось найти научную статью, где фибрилла коллагена состоит из 9 типов молекул.

user posted image
Подробнее: http://nanoworld88.narod.ru/data/266.htm
В данном случае спираль коллагена состоит из молекул коллагена одного типа.

Хотелось бы ознакомиться с результатами исследования такого типа коллагена.

Если автор правильно построил модель коллагена, то я бы воспользовался его скриптом, который он бесплатно раздаёт всем желающим:

-- Nanoworld Laboratory. Alexander Kushelev. Peptide pikotechnology - collagen model
-- http://nanoworld.narod.ru/
p = #()
angx = #(-24,180,60,-45,-45); angy = #(-10.89167,83,0,15,15); angz = #(92,120,60,110,110)
dx = #(2,1.5,1.6,2,2); dy = #(0.6,1,0.8,1,0.6); dz = #(-0.45,0,-0.6,-0.15,-0.45)
--collagen
kk = #(3,3,1,3,3,1,1,1,1,2,1,1,1,3,3,1,1,3,3,3,3,2,3,1,3,3,1,3,1,3,3,1,1,3,
1,1,3,3,1,3,1,1,3,1,3,3,1,4,1,3,1,1,1,3,3,3,1,3,1,1,3,1,1,1,1,1,3,3,
3,1,3,3,2,3,1,3,1,1,1,1,3,3,1,1,1,1,1,3,1,3,3,3,3,3,3,3,3,1,3,3,3,1,
1,1,3,1,1,1,3,3,1,2,1,3,1,1,1,1,1,3,1,1,1,3,1,1,1,2,1,3,3,1,1,3,3,3,
3,3,3,1,1,3,3,1,3,1,1,3,2,1,3,3,3,3,1,1,3,1,1,1,3,1,3,1,3,4,4,1,1,1,
1,1,1,1,1,1,1,3,1,1,3,3,1,1,1,3,3,1,1,1,3,1,1,1,4,3,3,1,1,1,1,1,1,1,
1,1,1,1,1,4,3,3,4,1,3,1,1,4,1,1,1,1,1,1,1,2,1,1,1,1,1,4,1,1,1,1,1,4,
1,4,1,1,1,4,1,1,1,1,3,1,1,1,1,1,1,1,1,3,1,1,1,1,1,4,1,1,1,1,4,1,4,1,
1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,4,3,1,1,1,1,1,1,1,1,1,4,3,1,
4,1,1,1,1,4,3,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,
1,1,1,1,3,1,1,1,3,1,1,1,1,4,3,3,1,1,1,3,4,1,1,4,1,4,1,1,1,1,1,1,1,1,
1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,3,4,4,1,1,2,1,1,1,1,1,1,1,
1,3,2,1,1,1,1,1,3,4,1,1,1,3,1,1,4,3,1,3,2,2,1,1,3,2,4,3,1,1,1,4,4,1,
1,4,1,4,1,1,3,1,1,3,3,1,1,3,1,3,4,1,1,3,3,1,3,1,1,1,1,1,1,1,1,1,3,1)
peptide = box length:1 width:1 height:1 position:[0,0,-.5] wirecolor:[250,250,250]; Converttomesh peptide
for k = 1 to 473 do(
element = Hedra family:1 scalep:100 scaleq:100 scaler:100 radius:1 pos:[0,0,0] p:0.4; Converttomesh element
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])
rotate peptide 30 [0,1,0]; move peptide [-21.5,5,0]

Этот скрипт строит по композиционному генетическому коду модель одной молекулы.

Дополнительный скрипт:

for k = 1 to 48 do(dd = mod k 2; p[k] = copy peptide wirecolor: [250,250*dd,250*dd]; p[k].pivot = [0,0,0]
ang = 30*k; rotate p[k] ang [0,0,1]; move p[k] [0,0,k*4.3])
gr1 = group #(peptide,p[1],p[2],p[3],p[4],p[5],p[6],p[7],p[8],p[9],p[10],p[11],p[12],p[13],p[14],p[15],p[16]
,p[17],p[18],p[19],p[20],p[21],p[22],p[23],p[24],p[25],p[26],p[27],p[28],p[29],p[30],p[31],p[32],p[3
3],p[34]
,p[35],p[36],p[37],p[38],p[39],p[40],p[41],p[42],p[43],p[44],p[45],p[46],p[47],p[48])
gr1.rotation.controller[3].controller.value = 0
animate on
at time 100 gr1.rotation.controller[3].controller.value = 60
gr1.pos.controller[3].controller.value = 0
animate on
at time 100 gr1.pos.controller[3].controller.value = 8.6

собирает из однотипных молекул спираль коллагена.

Автор утверждает, что программа-скрипт строит модель любого белка, в т.ч. коллагена автоматически, по кодирующей его нуклеотидной последовательности. Человек не принимает в этом процессе участия.

Не могу поверить, что эта спираль - случайное совпадение десятков геометрических параметров.

Где можно было бы найти структуру именно этого коллагена и сравнить форму спирали (шаг спирали, длину молекулы, толщину спирали) с экспериментальными данными?

Сообщение было отредактировано NMR-guy - 05.01.2012 13:49

  

  Белки -- статья в Википедии  
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 05.01.2012 13:56     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #7 множественное цитирование

Моделировать можно и нужно все что угодно, пикометровое разрешение тут виртуальное, потому такое маленькое.

Если у смоделлированной структуры настолько малая RMSD, что не привышает пикометров, то модель абсолютно бесполезная к решению практических задач (то есть - низкокачественная), так как в реальном коллагене атомы не могут настолько жестко находиться в пространстве, термодинамическая нестабильность в растворе должна некоторые участки расплетать и делать эти участки более гибкими, чем другие.

То есть, для аффтара: сделать твердое тело из спирали такого размера конечно можно, загнав по соображениям симметрии все атомы на место. Только вот реальный коллаген в растворе к этому будет иметь весьма малое отношение wink.gif

Как проверить структуру коллагена хотя бы с точностью до нанометра?

Никак, забудьте об этом, мой Вам совет. Или займитесь просчетом релаксации коллагена в качественном поле на хорошем суперкомпьютере с явно заданным электролитом вокруг.

Обязательно прочитайте работы по термодинамическому равновесию структур белка в растворах, по способам моделирования растворов in silico. Особо обратите внимание на понятие термодинамических колебаний структуры белка и ее термодиначической нестабильности, благодаря наличию которой белки и способны быть ферментами и рецепторами.

Приведенный Вами скрипт ничего не строит, он подгоняет любые вводимые сиквенсы к однажды просчитанной пространственной укладке аминокислот молекулы коллагена. Довольно веселая развлекуха наверное должно быть запихнуть туда кучу триптофанов и посмотреть что будет. К реальному миру в растворе это имеет небольшое отношение, хотя, малая вероятность что это зачем-нибудь будет полезно имеется.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 05.01.2012 14:43     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #8 множественное цитирование

(NMR-guy @ 05.01.2012 14:56)
Если у смоделлированной структуры настолько малая RMSD, что не привышает пикометров, то модель абсолютно бесполезная к решению практических задач (то есть - низкокачественная), так как в реальном коллагене атомы не могут настолько жестко находиться в пространстве, термодинамическая нестабильность в растворе должна некоторые участки расплетать и делать эти участки более гибкими, чем другие.


Автор утверждает, что это - начальная конформация, т.е. то, что делает рибосома. В физрастворе при изменении PH геометрия молекулы может не просто меняться, а перестраиваться вплоть до полной денатурации. Но его алгоритм чисто геометрический, т.е. физику не учитывает вообще. Её можно учесть с помощью дополнительных алгоритмов, которые в его программе ещё не реализованы.

Но он предлагает взять файл с координатами атомов, т.е. в стандарте PDB (Protein Data Base) и открыть с помощью браузера, в котором реализовано физико-химическое моделирование. И тогда можно будет хотя бы на уровне нанотехнологии увидеть динамику структуры белка. Но это будет нано-динамика. Для более точного моделирования, т.е. на уровне пико-динамики, нужно учесть форму элементов белка на уровне пикотехнологической модели. Тогда можно будет увидеть не нано-динамику, а пикодинамику молекулы.

Естественно, что колебательные движения элементов белка меняют форму, но среднее положение атомов может быть определено с пикометрической точностью.

user posted image

Та же четвертичная структура коллагена, где один многогранник изображает один аминокислотный остаток, т.е. точность упрощённой модели ~1нм.

user posted image
А это - упрощённая пикотехнологическая модель одной молекулы коллагена с точностью ~1нм.

user posted image
6 пикотехнологических (не упрощённых) моделей молекулы коллагена начинают образовывать спираль. Здесь точность уже пикотехнологическая (~1пм).

Сообщение было отредактировано Student2012 - 05.01.2012 14:51

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 05.01.2012 14:54     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #9 множественное цитирование

Никак, забудьте об этом, мой Вам совет. Или займитесь просчетом релаксации коллагена в качественном поле на хорошем суперкомпьютере с явно заданным электролитом вокруг.


Расчёт не подходит. Нужны экспериментальные данные о структуре этого коллагена. Или Вы точно знаете, что таких данных сегодня не существует?

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 05.01.2012 15:02     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #10 множественное цитирование

Приведенный Вами скрипт ничего не строит, он подгоняет любые вводимые сиквенсы к однажды просчитанной пространственной укладке аминокислот молекулы коллагена.


А почему тогда кодирующие последовательности разных белков дают на выходе скрипта разные формы?

angx=#(-24,180,60,-45,-45); angy=#(-10.89167,83,0,15,15); angz=#(92,120,60,110,110)
dx=#(2,1.5,1.6,2,2); dy=#(0.6,1,0.8,1,0.6); dz=#(-0.45,0,-0.6,-0.15,-0.45)
kk=#(1,1,4,1,1,4,1,4,4,1,4,1,4,1,4,1,1,1,4,1,1,4,1,1,4,4,3,3,4,1,4,1,1,1,1,1,4,1,1,3,1,1,1,1,1,4,1,1
,1,4,1,1,1,1,1,1)
peptide=box length:1 width:1 height:1 position:[0,0,-.5] wirecolor:[250,250,250]; Converttomesh peptide
for k = 1 to 56 do(
element = Hedra family:1 scalep:100 scaleq:100 scaler:100 radius:1 pos:[0,0,0] p:0.4; Converttomesh element
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])

Цитата: По композиционному коду (массив kk) скрипт строит модель белковой молекулы, в частности, инсулина.

user posted image

user posted image
Лизоцим куриного яйца тоже хорошо узнаваем.

user posted image
И фиброин...

user posted image
Модель гамма-тубулина.

user posted image
Модель альфа-тубулина. Субъединица A

user posted image
Модель альфа-тубулина. Субъединица B

user posted image
Система из A и B субъединиц альфа-тубулина

user posted image
13 пар субъединиц под электронным микроскопом кажутся 6+7, но это - иллюзия. Просто субъединица A находится как бы внутри субъединицы B ...

user posted image
Третья субъединица (Тау) (показана белым) присоединилась к первым двум A (красная) и B (зеленая). Конструкция Тау-субъединицы такова, что Тау (белая) может выполнять роль задвижки-домкрата, т.е. если её потянуть с небольшим усилием за хвостик, то центральная часть субъединицы раздвинет субъединицы A и B с большим усилием. При этом сначала хвостиком отодвинется крючок (зелёный), т.е. 13 элементов одного слоя микротрубочки расцепятся. А потом раздвинутся субъединицы A и B, что сделает невозможным сборку микротрубочки.

Чтобы лучше разобраться в механике тубулина, желательно распечатать модели субъединиц на 3D-принтере и сложить их вместе не в 3DS Max, а в реальном мире. Тогда этот механизм можно будет смоделировать гораздо точнее, чем в неосязаемом виртуальном мире 3DS Max. Можно, конечно, было бы поработать и в виртуальном мире со специальными перчатками, но это сильно дороже, чем 3D-распечатка субъединиц.

Конец цитаты.

Сообщение было отредактировано Student2012 - 05.01.2012 15:04

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 05.01.2012 15:10     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #11 множественное цитирование

Автор утверждает, что его программа автоматически определяет структуру белка по таблице композиционного генетического кода:

user posted image
Подробнее: http://nanoworld88.narod.ru/data/212.htm

При этом получаются формы известных белков, например, гистонов:

user posted image

шаперонов:

user posted image

А так выглядит вторичная структура белка, которую распечатывает программа 2D-пикотех:

user posted image
Подробнее: http://nanoworld88.narod.ru/data/208.htm

Композиционный код находится в правом столбце. Именно его нужно вставить в скрипт в качестве массива kk()

Автор предлагает всем желающим получить от него бесплатно пикотехнологическую модель интересующего их белка. Может быть кто-то сможет проверить, правильно строится модель или неправильно?

Может быть имеет смысл пригласить автора на этот форум, чтобы задать ему вопросы?

Сообщение было отредактировано Student2012 - 05.01.2012 15:14

  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 05.01.2012 22:40     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #12 множественное цитирование

А может автор построить структуру коннексина-26 (Cx26)? И его сборки в коннексон.

  

  Белки -- статья в Википедии  
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 06.01.2012 00:04     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #13 множественное цитирование

Дело в том, что в реальном мире геометрия белковых сверток не существует без физики, так как большая часть атомов на поверхностях интерфейсов молекул сильно поляризована или заряжена. Просто упаковывать боковые цепи аминокислот в пространстве мало, часть атомов КАТЕГОРИЧЕСКИ не захотят находиться в пространстве рядом с другим атомом соседней молекулы. Структура сия в реальности существовать просто не будет.

Судя по Вашим другим рассуждениям, Вы не поняли что я Вам посоветовал. А жаль, так как стабильная свертка - это результат работы именно электростатических сил притяжения и отталкивания, а только во вторую - геометрические соответствия поверхностей молекул (которые в случае чего могут быть компенсированы и молекулами воды). Поверьте, главное для структурного биолога - это не красивые картинки на экране и не отчеты с приставками нано-, обсужденные на сем форуме. Главное - это реалистичность представленных моделей. А когда прога берет и ищет имеющуюся свертку в базе данных структур, создает из них симметричную модель притирая в пространстве мономеры друг к другу по стерическим запретам, а потом красиво отрисовывает результат на экране - это принципиально не способно дать реалистичный НОВЫЙ результат.

Структуру полимера колагена я не нашел в RCSB PDB. Пока дальше моделей дело не идет, или идет, но неопубликовано. Сравнить действительно не с чем.

Кстати, я там увидел какие-то ноты в таблице с столбике. Это вообще что и зачем? Не затем, надеюсь, чтобы компенсировать нарушения физических законов при моделировании?

Также прошу топикстартера разъяснить отношения с этим самым Кушелевым, неким Эрнстом Мулдашевым и Петром Гаряевым.


  

  Белки -- статья в Википедии  
Участник оффлайн! Nastja
Постоянный участник
Новосибирск



 прочитанное сообщение 06.01.2012 06:40     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #14 множественное цитирование

Была такая идея про композитный код когда-то давно, не подтвердилась, но некоторых она еще будоражит.

  

  Белки -- статья в Википедии  
Участник оффлайн! Nastja
Постоянный участник
Новосибирск



 прочитанное сообщение 06.01.2012 06:41     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #15 множественное цитирование

Ну и кстати автору достаточно принять участие в следующем CASP, если он так уверен в своей программе. Сразу все оппоненты заткнутся.

Всего благодарностей: 1Поблагодарили (1): NMR-guy


  

  Белки -- статья в Википедии  
Guest
IP-штамп: frhlocrrtUszc
гость



 прочитанное сообщение 06.01.2012 09:25     Сообщение для модератора       
Цитировать Поместить сообщение в колонку новостей  URL #16 множественное цитирование

(Flyamer @ 05.01.2012 22:40)
Ссылка на исходное сообщение  А может автор построить структуру коннексина-26 (Cx26)? И его сборки в коннексон.

Для этого ему нужна нуклеотидная кодирующая последовательность этого белка. Либо в стандарте Генбанка, т.е. файл с расширением dne, либо в стандарте fasta. Если дадите ссылку или сам файл, то я попробую с помощью этого скрипта: http://nanoworld.narod.ru/EMBLReader023L_20101113.txt
получить третичную структуру белка. Что касается сборки, то не гарантирую, но попытаюсь.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 10:47     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #17 множественное цитирование

(NMR-guy @ 06.01.2012 01:04)
Ссылка на исходное сообщение  Дело в том, что в реальном мире геометрия белковых сверток не существует без физики, так как большая часть атомов на поверхностях интерфейсов молекул сильно поляризована или заряжена. Просто упаковывать боковые цепи аминокислот в пространстве мало, часть атомов КАТЕГОРИЧЕСКИ не захотят находиться в пространстве рядом с другим атомом соседней молекулы. Структура сия в реальности существовать просто не будет.


На первый взгляд кажется, что Вы правы, но если представить, что в генах закреплены удачные координаты атомов, а не случайные, то ситуация меняется. Естественный отбор отобрал те гены, где по программе атомы попадают на свои места, не нарушая законов физики. Неудачные комбинации генов отсечены естественным отбором. Если же генные инженеры начнут программировать форму белка без учётов законов физики и химии, то их синтетический белок, как Вы правильно написали, развалится с вероятностью близкой к единице.

(NMR-guy @ 06.01.2012 01:04)
Судя по Вашим другим рассуждениям, Вы не поняли что я Вам посоветовал. А жаль, так как стабильная свертка - это результат работы именно электростатических сил притяжения и отталкивания, а только во вторую - геометрические соответствия поверхностей молекул (которые в случае чего могут быть компенсированы и молекулами воды).


Так я и не спорю. Вы совершенно правы. Только в генах можно продублировать позиции атомов, которые не противоречат законам физики, химии и геометрии. Согласны? Как говорится, поставить атомы на свои места, причём сразу, по программе. Причём автор в своей рассылке показал, как конкретно работает механизм композиционного кодирования. При доставке аминокислоты на сайт сборки белка в рибосоме, антикодон находится впереди и вращается вместе с транстпортной РНК.

user posted image

Кинетической энергии тРНК достаточно, чтобы срезать комплементарный триплет иРНК,

user posted image

user posted image
Подробнее: http://nanoworld88.narod.ru/data/240.htm

который начинает вращаться вместе с тРНК, что связано с большой инерцией тРНК.

user posted image
Видео

Подробнее: http://nanoworld88.narod.ru/data/227.htm

При этом третий нуклеотид триплета иРНК остаётся свободным и вращается до тех пор, пока не встретит комплементарный нуклеотид рибосомальной РНК. Таким образом фиксируется угол поворота аминокислоты перед установкой её в растующую белковую цепь. После этого аминокислота вставляется в растущую белковую цепь под запрограммированным композиционным углом, согласно таблице композиционного генетического кода. тРНК поворачивается обратно, триплет иРНК возвращается на место, а тРНК сходит с рибосомы. Автор построил модель тРНК,

user posted image
Подробнее: http://nanoworld88.narod.ru/data/247.htm

комплекса тРНК+аминокислота и комплекса тРНК+триплет иРНК. Объяснить все эти модели сумасшедшими геометрическими совпадениями не представляется возможным...

(NMR-guy @ 06.01.2012 01:04)
Поверьте, главное для структурного биолога - это не красивые картинки на экране и не отчеты с приставками нано-, обсужденные на сем форуме. Главное - это реалистичность представленных моделей. А когда прога берет и ищет имеющуюся свертку в базе данных структур, создает из них симметричную модель притирая в пространстве мономеры друг к другу по стерическим запретам, а потом красиво отрисовывает результат на экране - это принципиально не способно дать реалистичный НОВЫЙ результат.


И снова Вы правы! Действительно таким способом ("притирая в пространстве мономеры друг к другу по стерическим запретам") реальную структуру молекулы белка не получить.

Так с Вами никто и не спорит! Алгоритм автора совсем другой. В его основе лежит таблица композиционного генетического кода. Мономеры не притираются, а сразу устанавливаются согласно композиционным углам. Поэтому модель крупного белка (тысячи аминокислотных остатков) строится за несколько секунд на обычном компьютере.

(NMR-guy @ 06.01.2012 01:04)
Структуру полимера колагена я не нашел в RCSB PDB. Пока дальше моделей дело не идет, или идет, но неопубликовано. Сравнить действительно не с чем.


Жаль. Тогда нужно найти белки с надёжно установленной структурой, чтобы проверить пикотехнологию на них.

(NMR-guy @ 06.01.2012 01:04)
Кстати, я там увидел какие-то ноты в таблице с столбике. Это вообще что и зачем? Не затем, надеюсь, чтобы компенсировать нарушения физических законов при моделировании?


Ноты рассчитываются по формуле Томсона для радикалов аминокислот. Длина радикалов известна. Известна и масса атомных ядер. Это позволяет рассчитать резонансные частоты по смешанной формуле пружинного и математического маятников. Прослушивая музыку сборки белка можно на слух определить гармоничные сочетания звуков, которые соответствуют биологически активным центрам белка. В частности, при сборке коллагена звучит фрагмент вальса Штраусса: http://www.nanoworld.org.ru/data/01/data/sounds/c01.mp3

(NMR-guy @ 06.01.2012 01:04)
Также прошу топикстартера разъяснить отношения с этим самым Кушелевым, неким Эрнстом Мулдашевым и Петром Гаряевым.


Ничего личного smile.gif Меня интересуют только научные результаты, научный подход, "сухой остаток".

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 10:58     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #18 множественное цитирование

(Nastja @ 06.01.2012 07:40)
Ссылка на исходное сообщение  Была такая идея про композитный код когда-то давно, не подтвердилась, но некоторых она еще будоражит.


А Вы не могли бы дать ссылку на исследование, где "не подтвердилось"? Очень не хочется тратить время на иллюзии...

(Nastja @ 06.01.2012 07:41)
Ссылка на исходное сообщение  Ну и кстати автору достаточно принять участие в следующем CASP, если он так уверен в своей программе. Сразу все оппоненты заткнутся.


Кушелев утверждает, что жульничают они, организаторы CASP. Вот история участия лаборатории Наномир в CASP-3: http://www.nanoworld.org.ru/data/01/data/e...0111/cafasp.htm

Лаборатория Наномир проходила под номером 33. А вот переписка с организатором конкурса: http://www.nanoworld.org.ru/data/01/data/e...0111/leszek.txt

Кушелев написал, что перед подведением итогов CASP3 5 участников из 33 исчезли из списка участников. Короче, тёмная история... Так что лучше иметь информацию из первых рук. У Вас лично есть данные о белках с надёжно установленной структурой? Хотелось бы на них проверить пикотехнологию. Если работает, буду пользоваться, если не работает, не буду время зря терять.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 11:16     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #19 множественное цитирование

(Flyamer @ 05.01.2012 23:40)
Ссылка на исходное сообщение  А может автор построить структуру коннексина-26 (Cx26)? И его сборки в коннексон.


Вы не могли бы уточнить, какую кодирующую последовательность взять по этой ссылке: http://www.ncbi.nlm.nih.gov/nuccore?term=c...xin%2026%20Cx26

Давайте посмотрим, например, этот ген: http://www.ncbi.nlm.nih.gov/nuccore/47938210?report=genbank

Сообщение было отредактировано Student2012 - 06.01.2012 11:40

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 11:39     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #20 множественное цитирование

Для скрипта достаточно этих строк:

CDS 145..825
ccgactcgga gcccctcggc ggcgcccggc ccaggacccg cctaggagcg caggagcccc
agcgcagaga ccccaacgcc gagacccccg ccccggcccc gccgcgcttc ctcccgacgc
agagcaaacc gcccagagta gaagatggat tggggcacgc tgcagacgat cctggggggt
gtgaacaaac actccaccag cattggaaag atctggctca ccatcctctt catttttcgc
attatgatcc tcgttgtggc tgcaaaggag gtgtggggag atgagcaggc cgactttgtc
tgcaacaccc tgcagccagg ctgcaagaac gtgtgctacg atcactactt ccccatctcc
cacatccggc tatgggccct gcagctgatc ttcgtgtcca cgccagcgct cctagtggcc
atgcacgtgg cctaccggag acatgagaag aagaggaagt tcatcaaggg ggagataaag
agtggattta aggacatcga ggagatcaaa acccagaagg tccgcatcga aggctccctg
tggtggacct acacaagcag catcttcttc cgggtcatct tcgaagccgc cttcatgtac
gtcttctatg tcatgtacga cggcttctcc atgcagcggc tggtgaagtg caacgcctgg
ccttgtccca acactgtgga ctgctttgtg tcccggccca cggagaagac tgtcttcaca
gtgttcatga ttgcagtgtc tggaatttgc atcctgctga atgtcactga attgtgttat
ttgctaatta gatattgttc tgggaagtca aaaaagccag tttaacgcat tgcccagttg
ttagattaag aaatagacag catgagaggg atgaggcaac ccgtgctcag ctgtcaaggc
tcagtcgcta gcatttccca acacaaagat tctgacctta aatgcaacca tttgaaaccc
ctgtaggcct caggtgaaac tccagatgcc acaatggagc tctgctcccc taaagcctca
aaacaaaggc ctaattctat gcctgtctta attttctttc acttaagtta gttccactga
gaccccaggc tgttaggggt tattggtgta aggtactttc atattttaaa cagaggatat
cggcatttgt ttctttctct gaggacaaga gaaaaaagcc aggttccaca gaggacacag
agaaggtttg ggtgtcctcc tggggttctt tttgccaact ttccccacgt taaaggtgaa
cattggttct ttcatttgct ttggaagttt taatctctaa cagtggacaa agttaccagt
gccttaaact ctgttacact ttttggaagt gaaaactttg tagtatgata ggttattttg
atgtaaagat gttctggata ccattatatg ttccccctgt ttcagaggct cagattgtaa
tatgtaaatg gtatgtcatt cgctactatg atttaatttg aaatatggtc ttttggttat
gaatactttg cagcacagct gagaggctgt ctgttgtatt cattgtggtc atagcaccta
acaacattgt agcctcaatc gagtgagaca gactagaagt tcctagtgat ggcttatgat
agcaaatggc ctcatgtcaa atatttagat gtaattttgt gtaagaaata cagactggat
gtaccaccaa ctactacctg taatgacagg cctgtccaac acatctccct tttccatgac
tgtggtagcc agcatcggaa agaacgctga tttaaagagg tcgcttggga attttattga
cacagtacca tttaatgggg aggacaaaat ggggcagggg agggagaagt ttctgtcgtt
aaaaacagat ttggaaagac tggactctaa attctgttga ttaaagatga gctttgtcta
cttcaaaagt taaaaaaaaa aaaaaaaaaa aaaaaaaaa
//

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 11:47     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #21 множественное цитирование

Кушелев по моей просьбе построил вторичную структуру Cx26:

user posted image

Композиционный код, полученный по программе Prosolver:

1,3,1,1,4,4,1,4,1,4,4,3,4,1,3,1,1,1,1,3,2,1,1,1,1,1,1,1,1,3
,3,1,3,1,1,1,3,4,3,2,1,1,4,1,2,3,1,1,1,1,3,1,1,1,1,4,1,2,1,1
,1,1,4,1,1,3,1,1,1,1,1,1,1,1,4,2,1,1,4,1,4,1,1,4,1,4,2,4,1,2
,4,1,1,1,4,1,1,4,3,3,1,1,1,1,1,1,1,1,4,1,2,1,3,2,3,1,1,1,1,1
,1,3,1,1,1,1,1,1,3,1,1,4,1,1,1,1,2,1,1,1,1,1,4,1,1,1,3,1,1,1
,1,1,1,1,3,1,1,1,1,1,1,1,1,1,4,4,4,1,1,1,1,1,3,3,1,1,3,4,1,1
,3,4,1,4,1,4,1,1,3,1,1,2,4,1,1,3,2,4,3,2,3,1,1,4,4,3,1,3,3,1
,3,3,1,2,3,3,3,3,3,4,1,2,3,1,2,3

Белок состоит из 226 аминокислотных остатков. Правильно?

Сообщение было отредактировано Student2012 - 06.01.2012 11:49

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 11:52     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #22 множественное цитирование

Скрипт для построения третичной структуры белка Cx26:

-- Nanoworld Laboratory. Alexander Kushelev. Peptide pikotechnology
-- http://nanoworld.narod.ru/
p = #()
angx = #(-24,180,60,-45,-45); angy = #(-10.89167,83,0,15,15); angz = #(92,120,60,110,110)
dx = #(2,1.5,1.6,2,2); dy = #(0.6,1,0.8,1,0.6); dz = #(-0.45,0,-0.6,-0.15,-0.45)
-- Cx26
kk = #(1,3,1,1,4,4,1,4,1,4,4,3,4,1,3,1,1,1,1,3,2,1,1,1,1,1,1,1,1,3
,3,1,3,1,1,1,3,4,3,2,1,1,4,1,2,3,1,1,1,1,3,1,1,1,1,4,1,2,1,1
,1,1,4,1,1,3,1,1,1,1,1,1,1,1,4,2,1,1,4,1,4,1,1,4,1,4,2,4,1,2
,4,1,1,1,4,1,1,4,3,3,1,1,1,1,1,1,1,1,4,1,2,1,3,2,3,1,1,1,1,1
,1,3,1,1,1,1,1,1,3,1,1,4,1,1,1,1,2,1,1,1,1,1,4,1,1,1,3,1,1,1
,1,1,1,1,3,1,1,1,1,1,1,1,1,1,4,4,4,1,1,1,1,1,3,3,1,1,3,4,1,1
,3,4,1,4,1,4,1,1,3,1,1,2,4,1,1,3,2,4,3,2,3,1,1,4,4,3,1,3,3,1
,3,3,1,2,3,3,3,3,3,4,1,2,3,1,2,3)
peptide = box length:1 width:1 height:1 position:[0,0,-.5] wirecolor:[250,250,250]; Converttomesh peptide
for k = 1 to 226 do(
element = Hedra family:1 scalep:100 scaleq:100 scaler:100 radius:1 pos:[0,0,0] p:0.4; Converttomesh element
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])

user posted image
Оригинал: http://img-fotki.yandex.ru/get/4427/126580...1c27ed_orig.gif

Третичная структура коннексина-26. В упрощённой пикотехнологической модели каждый аминокислотный остаток изображён одним 14-гранником.

Сообщение было отредактировано Student2012 - 06.01.2012 12:06

  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 06.01.2012 11:59     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #23 множественное цитирование

Да, например эта пойдет.

Или вот
ATGGATTGGGGCACGCTGCAGACGATCCTGGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGATCTGGCTCACCGTCCTCTTCATTTTTCGCATTA
TGATCCTCGTTGTGGCTGCAAAGGAGGTGTGGGGAGATGAGCAGGCCGACTTTGTCTGCAACACCCTGCAGCCAGGCTGCAAGAACGTGTGCTACGATCA
CTACTTCCCCATCTCCCACATCCGGCTATGGGCCCTGCAGCTGATCTTCGTGTCCACGCCAGCGCTCCTAGTGGCCATGCACGTGGCCTACCGGAGACAT
GAGAAGAAGAGGAAGTTCATCAAGGGGGAGATAAAGAGTGAATTTAAGGACATCGAGGAGATCAAAACCCAGAAGGTCCGCATCGAAGGCTCCCTGTGGT
GGACCTACACAAGCAGCATCTTCTTCCGGGTCATCTTCGAAGCCGCCTTCATGTACGTCTTCTATGTCATGTACGACGGCTTCTCCATGCAGCGGCTGGT
GAAGTGCAACGCCTGGCCTTGTCCCAACACTGTGGACTGCTTTGTGTCCCGGCCCACGGAGAAGACTGTCTTCACAGTGTTCATGATTGCAGTGTCTGGA
ATTTGCATCCTGCTGAATGTCACTGAATTGTGTTATTTGCTAATTAGATATTGTTCTGGGAAGTCAAAAAAGCCAGTTTAA

Это из генома (аннотированная собственно кодирующая последовательность).

  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 06.01.2012 12:00     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #24 множественное цитирование

Эм, у меня почему-то 227 получилось, но это ладно.

Картинку-то покажите))

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 12:18     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #25 множественное цитирование

(Flyamer @ 06.01.2012 12:59)
Ссылка на исходное сообщение  Да, например эта пойдет.

Или вот
ATGGATTGGGGCACGCTGCAGACGATCCTGGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGATCTGGCTCACCGTCCTCTTCATTTTTCGCATTA
TGATCCTCGTTGTGGCTGCAAAGGAGGTGTGGGGAGATGAGCAGGCCGACTTTGTCTGCAACACCCTGCAGCCAGGCTGCAAGAACGTGTGCTACGATCA
CTACTTCCCCATCTCCCACATCCGGCTATGGGCCCTGCAGCTGATCTTCGTGTCCACGCCAGCGCTCCTAGTGGCCATGCACGTGGCCTACCGGAGACAT
GAGAAGAAGAGGAAGTTCATCAAGGGGGAGATAAAGAGTGAATTTAAGGACATCGAGGAGATCAAAACCCAGAAGGTCCGCATCGAAGGCTCCCTGTGGT
GGACCTACACAAGCAGCATCTTCTTCCGGGTCATCTTCGAAGCCGCCTTCATGTACGTCTTCTATGTCATGTACGACGGCTTCTCCATGCAGCGGCTGGT
GAAGTGCAACGCCTGGCCTTGTCCCAACACTGTGGACTGCTTTGTGTCCCGGCCCACGGAGAAGACTGTCTTCACAGTGTTCATGATTGCAGTGTCTGGA
ATTTGCATCCTGCTGAATGTCACTGAATTGTGTTATTTGCTAATTAGATATTGTTCTGGGAAGTCAAAAAAGCCAGTTTAA

Это из генома (аннотированная собственно кодирующая последовательность).


Да, это та самая последовательность.

(Flyamer @ 06.01.2012 13:00)
Ссылка на исходное сообщение  Эм, у меня почему-то 227 получилось, но это ладно.

Картинку-то покажите))


227-ой триплет - терминирующий кодон

Этот белок не очень крупный, поэтому через несколько минут Вы сможете увидеть более детальную пикотехнологическую модель, построенную с помощью скрипта Савина-Кушелева Savin_s1.ms

Сообщение было отредактировано Student2012 - 06.01.2012 12:32

  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 06.01.2012 12:32     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #26 множественное цитирование

А его сборку в коннексон получится? Гексамер, грубо говоря.
И можно ли посмотреть не в виде многогранников, а в виде, например, спиралек и/или слоев?

Ну, странно, я трансляцию бластил, кажется... Ну, да не суть.

Сообщение было отредактировано Flyamer - 06.01.2012 12:33

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 12:34     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #27 множественное цитирование

(Flyamer @ 06.01.2012 13:32)
Ссылка на исходное сообщение  А его сборку в коннексон получится? Гексамер, грубо говоря.
И можно ли посмотреть не в виде многогранников, а в виде, например, спиралек и/или слоев?


Автоматически строится только третичная структура. С четвертичной нужно "колдовать" вручную, прикладывая по-всякому одну субъединицу к другой.

Желательно иметь дополнительную информацию, чтобы было понятно, что к чему прикладывать smile.gif

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 12:43     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #28 множественное цитирование

user posted image
Оригинал: http://img-fotki.yandex.ru/get/4427/126580...200185_orig.gif

Пикотехнологическая модель коннексина-26 (Cx26) / connexin-26. Каждый электрон поверхности изображён кольцом.

Кушелев советует распечатывать субъединицы на 3D-принтере и пытаться составить из них четвертичную структуру. Конечно, можно попытаться сложить субъединицы в 3DS Max, как это удалось в случае спирали коллагена и слоя микротрубочки, образованной 13-ю субъединицами, состоящими из A,B и гамма-тубулина. Но в виртуальном пространстве сконструировать четвертичную структуру сложнее, чем из 3D-распечаток.

Сообщение было отредактировано Student2012 - 06.01.2012 12:49

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 13:13     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #29 множественное цитирование

(Flyamer @ 06.01.2012 13:32)
И можно ли посмотреть не в виде многогранников, а в виде, например, спиралек и/или слоев?


У Виктории Соколик есть программа, написанная Prosolver, которая будет выводить файл координат в стандарте PDB. Этот файл можно будет смотреть стандартным браузером. Только в той программе не все композиционные углы настроены. Она показывает то же, что и эта 2D-пикотех: (ссылку не пропускает спам-фильтр. Ему не понравилось слово "Народ")

Можно попробовать убрать из модифицированной ссылки пробелы:

http://nanoworld2003.n a r o d.ru/20050216/index1.html

Нужно нажать третью вкладку "Edit Source" и вставить туда код:

60FT
FT source 1..10
FT CDS 1..681
XX
SQ Sequence 250 BP; 36 A; 105 C; 78 G; 31 T; 0 other;
ATGGATTGGG GCACGCTGCA GACGATCCTG GGGGGTGTGA ACAAACACTC CACCAGCATT
GGAAAGATCT GGCTCACCGT CCTCTTCATT TTTCGCATTA TGATCCTCGT TGTGGCTGCA
AAGGAGGTGT GGGGAGATGA GCAGGCCGAC TTTGTCTGCA ACACCCTGCA GCCAGGCTGC
AAGAACGTGT GCTACGATCA CTACTTCCCC ATCTCCCACA TCCGGCTATG GGCCCTGCAG
CTGATCTTCG TGTCCACGCC AGCGCTCCTA GTGGCCATGC ACGTGGCCTA CCGGAGACAT
GAGAAGAAGA GGAAGTTCAT CAAGGGGGAG ATAAAGAGTG AATTTAAGGA CATCGAGGAG
ATCAAAACCC AGAAGGTCCG CATCGAAGGC TCCCTGTGGT GGACCTACAC AAGCAGCATC
TTCTTCCGGG TCATCTTCGA AGCCGCCTTC ATGTACGTCT TCTATGTCAT GTACGACGGC
TTCTCCATGC AGCGGCTGGT GAAGTGCAAC GCCTGGCCTT GTCCCAACAC TGTGGACTGC
TTTGTGTCCC GGCCCACGGA GAAGACTGTC TTCACAGTGT TCATGATTGC AGTGTCTGGA
ATTTGCATCC TGCTGAATGT CACTGAATTG TGTTATTTGC TAATTAGATA TTGTTCTGGG
AAGTCAAAAA AGCCAGTTTA A
//

Ссылка на программу "Пикотех-2D" не проходит через спам-фильтр этого форума, поэтому можете взять её на форуме лаборатории Наномир: http://nanoworld.org.ru/post/8510/#p8510

Там же можно задать вопросы непосредственно Александру Кушелеву и Виктории Соколик.

user posted image

Сообщение было отредактировано Student2012 - 06.01.2012 13:43

  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 06.01.2012 13:36     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #30 множественное цитирование

Ок. Теперь скажите, пожалуйста, похоже ли это на реальную структуру, ка Вам кажется?
http://sci-hub.org/view/www.nature.com/nat...re07869_F2.html

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 13:52     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #31 множественное цитирование

(Flyamer @ 06.01.2012 14:36)
Ссылка на исходное сообщение  Ок. Теперь скажите, пожалуйста, похоже ли это на реальную структуру, ка Вам кажется?
http://sci-hub.org/view/www.nature.com/nat...re07869_F2.html


Давайте разберёмся...

user posted image

Первое, что бросается в глаза, это длинные, прямые спиральные участки на модели из Nature. Например, TM4 имеет 7 витков альфа-спирали. Программа Пикотех-2D показывает, что в состав белка входит одна длинная спираль (6 витков) и та гнутая, т.е. состоит из двух коротких участков альфа-спирали, разделённых коротким участком 310-спирали.

Как проверить, какая модель более правильная? Впечатляет то, что обе модели показывают одинаковую длину самого длинного участка с точностью до одного витка спирали.

Понятно, что ошибка интерпретации данных РСА на любую величину может означать ошибку на один атом, а ошибка на один атом может означать ошибку на один аминокислотный остаток, если атом находится на границе между ними. Наконец, ошибка на один аминокислотный остаток может означать ошибку на один виток альфа-спирали, если атом находится на границе между витками.

Таким образом длина самого длинного спирального участка совпала с точностью РСА.

Что касается дальнего порядка расположения атомных групп, то здесь нужно разбираться отдельно. Ведь другие спиральные участки в модели из Nature существенно длиннее, чем показанные программой Пикотех-2D. Промежутки, которые меньше 1 витка альфа-спирали, рентгеноструктурный метод не всегда замечает, как мы только что выяснили. Это значит, что с точностью до ошибки РСА (1 виток альфа-спирали) модели можно считать идентичными smile.gif

Кстати, более внимательное изучение модели из Nature помогло заметить, что все спирали гнутые. Так что совпадение моделей ещё лучше, чем казалось вначале.

Сообщение было отредактировано Student2012 - 06.01.2012 14:07

  

  Белки -- статья в Википедии  
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 06.01.2012 14:23     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #32 множественное цитирование

Господа, простите, но этот подфорум посвящен обсуждению НАУЧНЫХ методов познания и описания структур биообъектов.

В силу экспериментального выявления отсутствия у автора на данный момент понятия о том, что значит "научность", крайне сбивчивой и скользкой аргументации, странностей в собственных рассуждениях, и, главное, при отсутствии понимания того простого факта, что результаты должны поддаваться простой проверке на достоверность, ему предлагается продолжать обсуждение данной темы в "Беседе", где его гипотезу о естественном отборе вальсов Шопена в генетическом коде всегда найдется кому поддержать (квалифицированных эволюционистов там для такой гипотезы вполне достаточно).

Все последующие темы посвященные этим странным скриптам и картинкам будут переноситься в "Беседу", если их тут будет открываться слишком много, их авторы будут баниться за спам, гости будут баниться диапазонами айпи.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 14:29     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #33 множественное цитирование

Кроме того, нужно учитывать, что пикотехнологическая модель белка сильно упрощённая, т.е. в модели настроены только 4 варианта композиционных углов из 7. Не учитываются физические свойства аминокислот. В частности не учитывается гибкость пролина и особенности других аминокислот. Что это значит? Это значит, что молекула белка может изображаться в развёрнутом виде, как, например выпрямленная рука человека, которая в рабочем состоянии может быть согнутой.

В настоящее время реализован чисто геометрический алгоритм. Он подходит для тех белков, которые не меняют форму в процессе работы. Если же белок может гнуться во время работы, например, на таких амино/имино-кислотах, как пролин, то форма модели может заметно отличаться от формы реальной молекулы.

В таком случае можно попробовать довести модель вручную. Для этого нужно проверить, есть ли в составе белка пролин? Если есть, то в этих местах модель молекулы можно согнуть и посмотреть, будет ли она той же формы, что и реальная молекула?

В будущем, можно создать более продвинутые версии пикотехнологии, где будут учтены физико-химические взаимодействия. А пока мы имеем дело с чисто-геометрическим алгоритмом...

Тем не менее он может дать очень полезную информацию уже на уровне вторичной структуры, показывая где начинаются и где заканчиваются спиральные участки.

А жёсткие участки белка, т.е. без пролина, геометрический алгоритм может показать с пикометрической точностью.

Хотелось бы это проверить на белках, структура которых надёжно установлена.

  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 06.01.2012 14:31     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #34 множественное цитирование

Так, по-моему тут есть некоторая подмена понятий... Одно дело - определение вторичной структуры, которая, по Вашим словам, тут практически совпала (витки спиралей там...), и совсем другое - третичная, которая как раз нас и интересует. Со вторичной, насколько я знаю, проблем немного, ее умеют предсказывать в целом хорошо. А вот как раз с третичной - взаиморасположением разных частей, все крайне сложно. А как раз общая форма структур совпадает по-моему так себе (или надо нарисовать моделируемую структуру по-другому, чтобы стало видно сходство, может быть я чего-то не понимаю).

В принципе, я вообще не специалист по структурам, мягко говоря, но тем не менее, интересно.

Кстати, было бы интересно получить общее описание (на уровне идей) механизма работы программы.

PS
Я нисколько не поддерживаю эти методы, однако хочется найти реальные противоречия с экспериментальными данными, так сказать для честности.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 14:32     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #35 множественное цитирование

(NMR-guy @ 06.01.2012 15:23)
результаты должны поддаваться простой проверке на достоверность


А если проверка сложная, то это уже ненаучно? wink.gif

Вы согласны, что РСА может ошибаться на один виток альфа-спирали? Показать на виток меньше или на виток больше, чем есть на самом деле?

  

  Белки -- статья в Википедии  
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 06.01.2012 14:34     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #36 множественное цитирование

Как только запахнет научностью в обсуждении буду очень рад.
А то пока кроме ненужной никому пикометрической точности и веселых картинок ничего полезного не просматривается.

Лично мне уже все ясно, поэтому дальше тут общайтесь без меня, здесь тема научной быть не обязана, главное - никого не обижать на персональном уровне.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 14:42     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #37 множественное цитирование

(Flyamer @ 06.01.2012 15:31)
Ссылка на исходное сообщение  Так, по-моему тут есть некоторая подмена понятий... Одно дело - определение вторичной структуры, которая, по Вашим словам, тут практически совпала (витки спиралей там...), и совсем другое - третичная, которая как раз нас и интересует.


Не торопитесь делать выводы. Мы же решили разбраться, есть ли различия. Конечно, различия есть. На уровне первичной структуры они нулевые, т.к. аминокислотный состав определяется по таблице генетического кода.

На уровне вторичной структуры различия уже заметны. В модели из Nature мы видим 5 сравнительно длинных, с изгибами спиральных участков. Программа Пикотех показывает значительно больше коротких спиральных участков.

Какая из моделей точнее?

Точность РСА такова, что не позволяет отличить длинный участок спирали от коротких, разделённых неспиральными участками. Ведь длину альфа-спирального участка РСА позволяет определить с погрешностью в целый виток, т.е. 4-5 аминокислотных остатков.

Понимая это, можно сделать заключение, что с точностью РСА модели совпадают.

Но точность РСА не позволяет строить 3D модель. Как Вы себе представляете пространственную модель, если нет определённости, что она состоит из целых, а не поломанных спиралей? smile.gif

Кстати, было бы интересно получить общее описание (на уровне идей) механизма работы программы.


Первая статья на эту тему: http://www.nanoworld.org.ru/data/01/data/t...us/20000509.htm

В настоящее время готовится совместная статья Виктории Соколик и Александра Кушелева. Статья будет опубликована в течение ~50 дней.

Сообщение было отредактировано Student2012 - 06.01.2012 14:48

  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 06.01.2012 14:50     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #38 множественное цитирование

Ну, вот тут-то и получается, что проверить эти модели нельзя, потому что Вы сразу же говорите, что РСА неточен. Учитывая, что нет другого полноценного метода определения структуры, модели непроверяемы.

И про сходство третичной структуры Вы ничего не ответили.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 14:51     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #39 множественное цитирование

(NMR-guy @ 06.01.2012 15:34)
Ссылка на исходное сообщение  Как только запахнет научностью в обсуждении буду очень рад.
А то пока кроме ненужной никому пикометрической точности и веселых картинок ничего полезного не просматривается.

Лично мне уже все ясно, поэтому дальше тут общайтесь без меня, здесь тема научной быть не обязана, главное - никого не обижать на персональном уровне.


Ваши эмоции мне понятны, но хотелось бы видеть и аргументы. Вы не ответили на вопрос, согласны ли Вы, что ошибка РСА может достигать витка альфа-спирали, т.е. 4-5 аминокислот?

Если нет, то приведите аргументы в пользу своей точки зрения. Вы ведь за научный подход, верно? smile.gif

  

  Белки -- статья в Википедии  
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 06.01.2012 14:53     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #40 множественное цитирование

Вам там дело Настя посоветовала - если пройдете результатами работы своей программы CASP по их правилам, то в общем вне зависимости от наших персональных суждений Вас и Вашего Кушелева с Мулдашевым ждут заслуженное признание и почет, даже если Вы не будете объяснять как работает Ваша программа.

Аргументы моей точки зрения очень долго придется Вам объяснять. frown.gif Потому я даже не буду начинать. Все главное я Вам в теме уже написал, вы просто не смогли понять выше написанное по какой-то причине.

Про законы, работающие в настоящем ВСЕГДА на любом белковом объекте очень удачно обобщено в обзоре

Fersht A. — Structure and Mechanism in Protein Science

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 14:58     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #41 множественное цитирование

(Flyamer @ 06.01.2012 15:50)
Ссылка на исходное сообщение  Ну, вот тут-то и получается, что проверить эти модели нельзя, потому что Вы сразу же говорите, что РСА неточен. Учитывая, что нет другого полноценного метода определения структуры, модели непроверяемы.

И про сходство третичной структуры Вы ничего не ответили.


А кто говорит, что РСА точен? smile.gif И что мешает проверить пикотехнологию с помощью не очень точного РСА. Ведь с точностью до РСА можно? smile.gif

Что касается других методов проверки, то они существуют. Например, если программа отличает типы белков, то это уже хорошо. А если данные программы Пикотех совпадат с данными РСА с точностью РСА, то это совсем хорошо. Разве нет?

Что касается сходства третичной структуры, то с точностью РСА сходство есть. Ведь РСА не отличает длинные участки спирали от коротких, разделённых поворотами. Давайте попробуем найти способ более тщательной проверки.

Точность РСА, как я понял, не устраивает ни Вас, ни меня.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 15:03     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #42 множественное цитирование

(NMR-guy @ 06.01.2012 15:53)
Ссылка на исходное сообщение  Вам там дело Настя посоветовала - если пройдете результатами работы своей программы CASP по их правилам, то в общем вне зависимости от наших персональных суждений Вас и Вашего Кушелева с Мулдашевым ждут заслуженное признание и почет, даже если Вы не будете объяснять как работает Ваша программа.


У организаторов CASP, как я понял, "двойные стандарты", если число участников конкурса может уменьшаться с 33 до 28 перед финалом конкурса. Но в данном случае меня интересуют не Ваши эмоции, а Ваши аргументы, если, конечно, Вы на деле, а не на словах сторонник научного подхода.

Поэтому хотелось бы в Вашем ответе услышать аргументы по поводу точности РСА, а не фамилию Мулдашева или ещё кого-то smile.gif

  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 06.01.2012 15:08     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #43 множественное цитирование

Что Вы имеете в виду под тем, что программа отличает типы белков?

Не думаю, что РСА с 3,5 ангстремовым разрешением ошибается в том, спираль это или несколько. Кроме того, это РСА не одного белка, а целого канала, и все кусочки в нем хорошо складываются в целое, так что я склонен ему верить.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 15:16     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #44 множественное цитирование

Под "отличает типы белков" я имею ввиду это:

user posted image
user posted image

Если заменить в программе таблицу композиционного генетического кода на случайную таблицу, то различие типов белков исчезнет:

user posted image

Что касается ангстремного разрешения РСА. Допустим, что разрешение ангстремное. Но Вы согласны, что ошибаясь на 1 ангстрем можно ошибиться не только на 1 атом, но и на 1 аминокислотный остаток, если атом находится на границе между ними?
А если это является границей между витками альфа-спирали, то ошибаясь на атом мы автоматически ошибаемся на виток альфа-спирали. Согласны?

Кроме того, подтверждение витковой точности РСА легко найти в PDB. Ведь каждый год структуры белков уточняются, при этом новые структуры отличаются от старых числом спиральных участков... smile.gif

Сообщение было отредактировано Student2012 - 06.01.2012 15:18

  

  Белки -- статья в Википедии  
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 06.01.2012 15:19     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #45 множественное цитирование

у этих ребят как раз никаких двойных стандартов нет - потому как только жулики и обманщики с этим ознакамливаются, они сразу отваливаются, 5 отвалившихся из 28 это еще не много, раньше горе-гениев было гораздо больше. Но такова наука - полученную в реальности структуру вырубить никаким топором нельзя, показания приборов можно всегда легко перепроверить и во всем убедиться.

  

  Белки -- статья в Википедии  
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 06.01.2012 15:22     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #46 множественное цитирование

(Student2012 @ 06.01.2012 07:03)
Ссылка на исходное сообщение  У организаторов CASP, как я понял, "двойные стандарты", если число участников конкурса может уменьшаться с 33 до 28 перед финалом конкурса. Но в данном случае меня интересуют не Ваши эмоции, а Ваши аргументы, если, конечно, Вы на деле, а не на словах сторонник научного подхода.

Поэтому хотелось бы в Вашем ответе услышать аргументы по поводу точности РСА, а не фамилию Мулдашева или ещё кого-то smile.gif

Просто пролистайте Выше, все мои аргументы Вам уже давно изложены, и они в отличие от Вашей позиции и картинок никогда не поменяются.

  

  Белки -- статья в Википедии  
Участник оффлайн! Student2012




 прочитанное сообщение 06.01.2012 15:25     Сообщение для модератора         Личное письмо
Цитировать Поместить сообщение в колонку новостей  URL #47 множественное цитирование

Может быть объясните тогда, почему организаторы CASP 2 месяца заботливо присылали кодирующие последовательности и к концу конкурса накопили на сервере 40 структур от лаборатории Наномир, а накануне подведения итогов все результаты, в т.ч. других 4 лабораторий неожиданно исчезли? Почему не за месяц или не за неделю? И почему именно из списка участников? Речь же не идёт о списке победителей. smile.gif

И хотелось бы услышать от Вас не только эмоции, но и аргументы. Напомню, что вопрос был задан о точности РСА. Вы согласны, что длину спиральных участков РСА позволяет определить с погрешностью в целый виток?

Кстати, если бы организаторы CASP решили, что лаборатория Наномир - жулики, то почему они ежегодно присылают приглашения на CASP? Где логика? Почему они просят у жуликов структуры белков? smile.gif

Просто пролистайте Выше, все мои аргументы Вам уже давно изложены


Я не нашёл Ваших аргументов в защиту точности РСА. Вы не могли бы их повторить "здесь и сейчас"? smile.gif

Сообщение было отредактировано Student2012 - 06.01.2012 15:29

  

  Белки -- статья в Википедии  
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 06.01.2012 15:46     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #48 множественное цитирование

Просто пролистайте Выше, все мои аргументы Вам уже давно изложены, и они в отличие от Вашей позиции и картинок никогда не поменяются.

Всем читателям полезно ознакомиться со следующимЫмДыбрЪ:

http://lamerodrom.ru/wp-blog/category/nesu_raznoe/kushelev/

http://www.eva.vnt.ru/discussion_club/viewforum.php?f=27

Сие для меня было весьма удивительными подборками, никак не ожидал, что мое мнение так быстро совпадет с общественным при анализе научности материала в рамках всего-то этой темы.

  

  Белки -- статья в Википедии  
Участник оффлайн! NMR-guy
Постоянный участник
временной жизни



 прочитанное сообщение 06.01.2012 16:01     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #49 множественное цитирование

Еще кое-что, но это для модераторов Беседы будет полезно для ознакомления.

http://electronix.ru/forum/index.php?showtopic=4110&st=750

  

  Белки -- статья в Википедии  
Участник оффлайн! Flyamer
Постоянный участник
Москва



 прочитанное сообщение 06.01.2012 16:05     Сообщение для модератора         Личное письмо  Отправить e-mail
Цитировать Поместить сообщение в колонку новостей  URL #50 множественное цитирование

Короче говоря, Вы утверждаете, что эта программа работает лучше, чем эксперимент - РСА, в это я поверить не могу, эксперимент всегда прав, особенно если это общепринятый метод.

  

  Белки -- статья в Википедии  

*




Кнопка "Транслит" перекодирует
текст из транслита в кирилицу.
Правила перекодировки здесь;
текст в квадратных скобках'[]'
не преобразуется.
Имя:

 преобразовывать смайлики · показать смайлики
Назначение кнопок:

   Поблагодарить автора сообщения — поблагодарить автора
   Удалить сообщение — удалить
   Редактировать сообщение — редактировать
   Поместить сообщение в колонку новостей — поместить в колонку новостей
   Цитировать — цитировать сообщение
   не входит в цитирование/входит в цитирование — цитировать несколько
   Отметить СПАМ-сообщение — обозначить спам
   Сообщение для модератора — связь с модератором
   Участник онлайн!/Участник оффлайн! — автор онлайн/оффлайн
   Фотография — фотография автора

   - остальные обозначения -
 
   *
« Предыдущая тема · Заблудшие темы · Следующая тема »
Быстрый ответДобавить сообщение в темуСоздать новую тему

Rambler   molbiol.ru - методы, информация и программы для молекулярных биологов              

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

Хеликон · Диаэм · ИнтерЛабСервис · Beckman Coulter · SkyGen · ОПТЭК · BIOCAD · Евроген · Синтол · БиоЛайн · Sartorius · Химэксперт · СибЭнзим · Tecan · Даниес · НПП "ТРИС" · Биалекса · ФизЛабПрибор · Genotek · АТГ Сервис Ген · Биоген-Аналитика
Ваш форум  ·  redactor@molbiol.ru  ·  реклама  ·  Дата и время: 28.01.23 15:34
Bridged By IpbWiki: Integration Of Invision Power Board and MediaWiki © GlobalSoft