Web-сайт MolBiol.ru
 

English   Deutsche Fassung  Український варіант
[Войти] [Регистрация]
Софт
всего сообщений: 30   страницы (2):  1 2 >

раздел новостей: Софт Сервер по биоинформатике Bri-shur.com
30.03.2011 16:39  Сергей Феранчук / Redactor           к началу страницы  комментарии: 2
картинка: kozlik.jpgУважаемые коллеги!

Приглашаем вас на сайт bri-shur.com где мы настроили биоинформатические сервисы, основанные на свободных пакетах ПО и на собственных оригинальных разработках.
На сайте представлены:
  • скрининг по гомологии по заданной аминокислотной последовательности
  • скрининг по регулярному выражению (паттерну)
  • множественное выравнивание
  • филогенетический анализ
  • гомологичное моделирование
  • предсказание вторичной структуры и поверхностных участков белка
  • структурное выравнивание
  • предсказание протонированных сайтов гистидина в заданной структуре
  • оценка энергии сворачивания для заданной структуры
  • ряд других утилит


Скрининг по гомологии производится на основе оригинального алгоритма группы genebee, который для некоторых задач превосходит по качеству поиска общеизвестный алгоритм blast. Также представлены оригинальные алгоритмы множественного выравнивания и оценки качества трехмерной модели белка.


Сервисы на сайте максимально интегрированы, нескольких кликов достаточно, чтобы, подав на вход аминокислотную последовательность, найти гомолог в базе PDB, провести парное выравнивание и гомологичное моделирование, построить трехмерную структуру, оценить ее качество и подготовить структуру для молекулярно-динамических расчетов.


Также работает собственная поисковая система по базе Medline, где для удобства навигации по биологической литературе используются подсказки на основе ключевых фраз (мемов), выделенных в рефератах статей.
Сервисы на сайте представляются бесплатно и без регистрации, с русскоязычным интерфейсом.


Мы очень надеемся что наш проект будет востребован российским биоинформатичеким сообществом.

http://bri-shur.com

Всего благодарностей: 16Поблагодарили (16): Mike Shelk, giraffa, Julchik, nakushok, polosataya, daniil naumoff, klav, Atropos, elena.ilina, Vadim Sharov, inview, Msim, AlenaKashina, abblackhole, Юлишна, Student



раздел новостей: Софт ZBIOROBOT: помощник для отсылающих статьи на форуме Full Text;  скачать и установить
11.01.2006 20:01  Redactor             к началу страницы  комментарии: 29
Программа ZBIOROBOT автоматически отсылает статьи по запросам на форуме Full Text. Программа будет полезна, если у вас есть доступ к полным текстам статей в некоторых журналах и вы готовы отсылать статьи по запросам на форуме Full Text, но хотели бы сэкономить драгоценное время на хождение по ссылкам.

При запуске программы на вашем компьютере она сама идет на форум, находит открытый запрос, идет по ссылке в нем, пытается скачать pdf (пользуясь имеющимся у вас доступом), если это удается - отсылает pdf по e-mail и закрывает запрос. Таким образом, она делает то же самое, что сейчас вы, скорее всего, делаете вручную. Программа работает под Windows (в виде exe-файла) или под Linux (исходный код на языке Perl). Подробности - в файле readme.

Статьи от робота будут приходить с адреса ***@mail.ru . Это неплохо, так как чтобы разобраться, от кого пришла статья придётся затребовать информацию от сервиса mail.ru

Комментарии и предложения по работе программы присылайте, пожалуйста, на адрес molbiol-robot@nm.ru

Файлы программы прикреплены к этому сообщению.
  • zbio.exe - версия для Windows, ssl-авторизация не требуется
  • zbio_ssl.exe - версия для Windows в случае, если Ваш сервер исходящей почты требует ssl-авторизации ("secure SMTP"; например, GMail и многие корпоративные серверы).
  • zbio_linux.zip - версия для Linux (исходный код на Perl)


Файл/ы:

скачать файл zbio.zip
размер: 1.3мб
кол-во скачиваний: 397



скачать файл readme.doc
размер: 61к
кол-во скачиваний: 274



скачать файл zbio_linux_0.9b.zip
размер: 214.19к
кол-во скачиваний: 163



скачать файл zbio_ssl.zip
размер: 1.88мб
кол-во скачиваний: 327




раздел новостей: Софт The R Project for Statistical Computing;  Версия 2.3.1 и русский язык
25.06.2006 02:43  plantago           к началу страницы  комментарии: 1
user posted image
Несколько запоздалая новость, но все же:
Вышла версия 2.3.1 статистической среды R ( http://www.r-project.org ) -- GNU-аналога S-PLUS. R -- это расширяемая интерактивная среда, которая одновременно является и языком программирования. В результате получилось одно из самых мощных средств анализа данных на компьютере, на уровне SAS (впрочем, многие считают, что SAS хуже). R -- один из самых быстро развивающихся open source проектов. Как иллюстрация -- количество пакетов расширений за последний год увеличилось почти вдвое, сейчас их около 750. Многим на форуме будет интересен ориентированный на геномику проект Bioconductor ( http://www.bioconductor.org ), в котором собрано около 20 специализированных пакетов для R.
Версия 2.3.1 интересна в основном тем, что отражает результаты почти полной интернационализации R. Русский язык теперь может использоваться практически во всех элементах статистической среды. Однако осталось еще немало непереведенного на русский материала, и я, как переводчик R (похоже, что на текущий момент единственный в команде frown.gif ), прошу заинтересовавшихся помочь мне закончить перевод.
Кроме того, надо повышать популярность R в русскоязычной среде. Повальное увлечение всяким "добром" типа M$ Excel и STATISTICA до добра не доведет... Почти все мои публикации идут с использованием R, но других подобных примеров я не знаю. Опять же, практически нет русскоязычных материалов по R (у меня есть заметки здесь -- http://herba.msu.ru/shipunov/software/r/r-ru.htm ; и проект книжки, но пока все стоИт). Если у кого-нибудь есть что-то про R по-русски, я готов размещать эти материалы.

Всего благодарностей: 18Поблагодарили (18): AVP, Nastja, Danse, Дядя ФАКСер, olkol, ivank, KoP, физиолух, Piter_, mpyat, shum, AE, gav, Gogy, Amadeus, Saveta, NMR-guy, Surikap


раздел новостей: Софт Программа "Анализ последовательности белка"
25.09.2003 12:18  Redactor           к началу страницы  комментарии: 0
В разделе "Расчёты" появилась новая программа: "Анализ последовательности белка" от Клименкова Виталия (web-сайт "Биохимия-онлайн"). Программа рассчитывает брутто-формулу (с учетом естественного содержания изотопов), процентный состав, изоэлектрическую точку, заряд при заданном pH и молекулярный вес белков.
Кроме того, на сайте автора можно взять аналогичную программку ProtCalc, работающую локально. ProtCalc имеет большие возможности редактирования белковой последовательности (многострочный редактор, функции поиска), чем он-лайн версия (установка не требуется).


раздел новостей: Софт BioMail опять работает
19.06.2003 03:20  Redactor           к началу страницы  комментарии: 3
Опять работает BioMail (проблема была описана в новостях от 28.05.2003). Кстати, пока ставил поправленную версию, посмотрел статистику программы. Искренне удивился, что БиоМэйлом пользуется меньше людей, чем подписано на рассылку сайта: 1631 и 2238 человек соответственно. Странные люди. Автоматический поиск в PubMed гораздо важнее новостей molbiol.ru. Сам пользуюсь, всех знакомых уговорил и вам искренне советую.

PS. Для тех, кто не в курсе, о чём идёт речь - ссылка на статью о программе.
PSS. Можно выбрать язык программы: русский, английский, французский, итальянский, испанский.
PSSS. В ходе обсуждении речь зашла об альтернативных (бесплатных!) программах.
Итак, поиск по тексту:
Поиск последовательностей: Раньше ещё существовала программа "Peer Bork's lab at EMBL": BLAST поиск белковых и НК последовательностей. Но теперь она закрыта из-за отсутствия поддержки.
Я что хочу сказать: пусть не BioMail, но чем то в этом роде пользоваться нужно.


раздел новостей: Софт Тем, кто пользуется BioMail
28.05.2003 20:20  Redactor           к началу страницы  комментарии: 0
С пятницы 23 Мая BioMail не работает. Создатели программы (Dmitry Mozzherin, BioMail Team) знают о проблеме и постараются решить её как можно скорее.

Дело в том, что работа программы BioMail сильно зависит от структуры базы данных PubMed — http://pubmed.org. Недавно структура PubMed была модифицирована. Сейчас требуется приспособить программу BioMail к новым условиям.


раздел новостей: Софт Улучшены программы раздела Расчёты
09.03.2003 03:05  Redactor           к началу страницы  комментарии: 0
Улучшены программы раздела "Расчёты".
Во-первых, теперь как точка, так и запятая могут служить разделителем дробной и целой части (а то я умаялся помнить, что является разделителем для Excel, а что - для javascript). Формат вывода не изменился, а вот при вводе можно с равным успехом использовать и то и другое. Это касается и программ раздела "Расчёты" и форм для пересчёта рецептов растворов.
Там, где это полезно, введена возможность изменять формат вывода нуклеотидных последовательностей.

Операции с нуклеотидной последовательностью (НП)

Регистр; U/T; Пропуск

Поиск редких кодонов

Регистр; U/T

Пересортировка НП

Регистр; U/T

Случайная НП

Регистр; U/T


раздел новостей: Софт Программа "случайная последовательность нуклеотидов
06.11.2002 17:41  Redactor           к началу страницы  комментарии: 0
Новая программа: "Случайная последовательность нуклеотидов". Она умеет генерировать случайные последовательности с заданным GC-составом.

> 220 nucleotides; random sequence with 15% GC
TTATGTATATTTTTTAGAAGTTTTAAAGAATAAAAATTTATGCAATATGT
TATCGTTATAATAATAACAGTGTAAAATACCATTAATTTTTATAAAACTT
ATTCGTTAGTATTTATTATATTTTTCAGATAGAATTTAATAAGAATTGTT
TCTTTTAAACTAAGCATTATAATATTTTTGAATAATAGACTATTTATGAT
TATGATTTTCATTTAAATTT


раздел новостей: Софт Диаграмма частоты встречаемости кодонов
31.10.2002 15:13  Redactor           к началу страницы  комментарии: 0
В разделе "Расчёты" модифицирована программа "Поиск редких кодонов в кодирующей последовательности" (для тех, кто не в курсе - оценка частоты встречаемости кодонов полезна при экспрессии белков в гетерологичных организмах). Функционально программа не изменилась, но результат представляется теперь более наглядно: кроме всего прочего рисуется гистограмма частот встречаемости кодонов. Например, анализ кодирующей последовательности Taq полимеразы при экспрессии в E.coli даёт следующие результаты:



> Taq polymerase translated in organism: Escherichia coli

..1 mRgmlplfep kgrvllvdgh hlayrtfhal kglttsrgep vqavygfaks
.51 llkalkedgd avivvfdaka psfrheaygg ykagraptpe dfprqlalik
101 elvdllglar levpgyeadd vlaslakkae kegyevrilt adkdlyqlls
151 drihvlhpeg ylitpawlwe kyglRpdqwa dyraltgdes dnlpgvkgig
201 ektaRkllee wgsleallkn ldrlkpaire kilahmddlk lswdlakvrt
251 dlplevdfak RrepdreRlR afleRlefgs llhefglles pkaleeapwp
301 ppegafvgfv lsrkepmwad llalaaaRgg rvhrapepyk alRdlkearg
351 llakdlsvla lReglglppg ddpmllayll dpsnttpegv arryggewte
401 eageraalse RlfanlwgRl egeeRllwly reveRplsav lahmeatgvr
451 ldvaylRals levaeeiarl eaevfrlagh pfnlnsrdql eRvlfdelgl
501 paigktektg krstsaavle alreahpive kilqyreltk lkstyidplp
551 dlihpRtgrl htrfnqtata tgRlsssdpn lqnipvrtpl gqRirrafia
601 eegwllvald ysqielRvla hlsgdenlir vfqegrdiht etaswmfgvp
651 reavdplmrr aaktinfgvl ygmsahrlsq elaipyeeaq afieryfqsf
701 pkvrawiekt leegRRrgyv etlfgrrryv pdlearvksv reaaermafn
751 mpvqgtaadl mklamvklfp RleemgaRml lqvhdelvle apkeRaeava
801 rlakevmegv yplavpleve vgigedwlsa ke*
user posted image


раздел новостей: Софт Новая программа на JavaScript
22.10.2002 14:05  Redactor           к началу страницы  комментарии: 0
Новая программа: "Трёхбуквенные-однобуквенные аминокислотные последовательности". Облегчает жизнь, когда требуется перевести однобуквенную аминокислотную последовательность в трёхбуквенную (например, когда код толком не помнишь), или наоборот - переписать трёхбуквенную (например, для ввода в компьютер). Однобуквенная запись по желанию - прописными или строчными буквами. Заодно программа считает молекулярный вес белка (чтобы не выглядеть совсем уж примитивной).
Обычное напоминание: все программы в разделе "Расчёты" написаны на JavaScript. Если сохранить страницу на локальном компьютере, программа будет работать. Код очень простой и его можно переделать (или оптимизировать) под собственные нужды.


раздел новостей: Софт Чтение вслух нуклеотидной последовательности
02.06.2002 12:30  Redactor           к началу страницы  комментарии: 0
В разделе "Расчёты" появилась новая программа: чтение вслух нуклеотидной последовательности. Она пригодится, когда требуется проверить, например, последовательность заказанных олигонуклеотидов. Можно произвольно задать скорость чтения, выбрать русского или английского диктора. Есть команды "пауза" и "начать сначала". Понимаются стандартные обозначения полиморфных нуклеотидов.
Русский голос: диктор Екатерина Петрова, записал Владимир Рябов (радио Мордовии). Большое им спасибо!
На всякий случай: для того, чтобы компьютер что-то читал, нужно, чтобы была установлена звуковая карта и колонки, smile.gif .


раздел новостей: Софт Ещё о перекодировке
14.05.2002 10:14  Redactor           к началу страницы  комментарии: 0
Совсем забыл упомянуть о том, что перекодировщик написан на JavaScript и исполняется на компьютере пользователя.
Тем, кто понимает: если появятся идеи по поводу улучшения перекодировщика - можете сами переписать программу (она очень короткая).
Для неспециалистов только вывод - достаточно сохранить на своём компьютере любую страницу форума и у вас будет собственный перекодировщик (то же самое - для всех программ из раздела "Расчёты" и виртуальных клавиатур со страниц поисков (по сайту и по форуму).
Чужие транслитовские тексты теперь можно читать после перекодировки: копируете сообщение в окно отправки и жмёте кнопку "Транслит" (я именно так и поступаю).


раздел новостей: Софт Biomail - версия 0.70
18.01.2002 18:26  Redactor           к началу страницы  комментарии: 0
Дима Мозжерин (dim@pharm.sunysb.edu) прислал новую версию (0.70) программы BioMail. Некоторые достоинства новой версии перечислены ниже. Огромное спасибо автору и удаче в работе всем пользователям!
Для тех, кто не в курсе: речь идёт о программе, помогающей следить за текущей биологической и медицинской литературой. На основе заданного пользователем поискового шаблона BioMail автоматически проводит поиск в PubMed (Medline) и присылает результаты поиска по e-mail (еженедельно, два раза в неделю или раз в месяц, по выбору). Каждый раз поиск проводится среди новых статей, поступивших в PubMed, так что пропусков или повторов не бывает. Программа совершенно бесплатная и очень полезная (не разочаровался никто из тех, кто пробовал пользоваться).
Что касается нашего сервера и многоязыковой поддержки. Выбор языка и кодировки проводится дважды: (i) при выборе языка программы BioMail и (ii) при выборе языка писем. Может быть, стоит попробовать разные сочетания: на мой компьютер читаемые письма приходят, лишь если задать "Russian koi8" в обоих случаях.
Новая программа проверяет правильность e-mail адреса и сообщает администрации сайта о проблемах с доставкой почты. Все проблемные подписки будут временно заблокированы. Чтобы разблокировать подписку, хозяину достаточно будет зайти на страницу настроек поисков и снять выбор опции "Временно приостановите мою BioMail-почту".


Достоинства BioMail 0.70:
Программа имеет многоязыковую поддержку. Язык выбирается каждым пользователем индивидуально. Русский язык уже работает (однако, по умолчанию поставлен английский, так как приблизительно половина пользователей программы - иностранцы). Вскоре обещают французский и испанский. Если кто-то хочет поучаствовать в переводе на другие языки - свяжитесь, пожалуйста, с Димой Мозжериным (dim@pharm.sunysb.edu).

Теперь можно получать полнофункциональные письма используя любую почтовую систему. Если нет возможности работать непосредственно с письмами в формате HTML, можно получать ссылки в прикреплённых HTML файлах.
Те, кто предпочитает использовать широкие поисковые термины (например, 'cancer'), может существенно улучшить специфичность поиска используя опцию "Только индексированные ссылки". В этом случае, поиск будет использовать "ключевые слова" PubMed - MeSH термины.

Те, кто проводит несколько поисков, теперь может получать результаты в одном письме.
Кроме того, ряд непринципиальных, но приятных улучшений: расширенный FAQ, временная приостановка подписки на BioMail и т.п.


раздел новостей: Софт Jellyfish - программа для мол. анализа
21.12.2001 18:13  Redactor           к началу страницы  комментарии: 0
Компания LabVelocity предлагает всем желающим (после регистрации, конечно) бесплатную молекулярно-биологическую программу для генетического анализа: Jellyfish - версия 1.5. Графический интерфейс, доступ ко множеству интернет-инструментов и т.п.


раздел новостей: Софт Visual Cloning 2000
12.12.2001 17:21  Redactor           к началу страницы  комментарии: 0
Новая работа Игоря Хмелькова (IKhmelkov@IBS.RU). На этот раз - описание свойств и пример работы с программой для молекулярного клонирование "Visual Cloning 2000" компании Redasoft Corporation. Подготовлено три страницы: "Возможности Visual Cloning 2000", "Первый опыт работы с Visual Cloning 2000", "Visual Cloning 2000 – работаем с Интернет". Всё выложено в разделе "Литература". Всем приятного чтения, а автору - огромная благодарность.


раздел новостей: Софт Окончание Vector NTI по русски
05.10.2001 13:06  Redactor           к началу страницы  комментарии: 0
Игорь Хмельков (IKhmelkov@IBS.RU) выложил, по-видимому, последнюю часть описания программы Vector NTI: "Расширенный дизайн молекул". Честь и хвала автору! Версию для печати в формате MS Word можно забрать с сайта самого Игоря "WETWARE", посвящённого всему, что находится на стыке био- и информационных технологий (биокомпьютеры, биопроцессоры, биочипы).


раздел новостей: Софт Новые программы
04.10.2001 13:02  Redactor           к началу страницы  комментарии: 0
На сайте выложены две новые формы.
"Операции с нуклеотидной последовательностью" - умеет проводить простейшие манипуляции (чтение в обратную сторону, чтение комплементарной последовательности, перевод в двухцепочечную), понимает стандартные обозначения полиморфных нуклеотидов. Можно проводить как одиночное преобразование, так и несколько преобразований одновременно.
"Трансляция нуклеотидной последовательности" - проводит трансляцию нуклеотидной последовательности в выбранных рамках считывания, понимает стандартные обозначения полиморфных нуклеотидов. Можно выбирать несколько рамок одновременно. Можно переключаться между трёхбуквенным и однобуквенным кодом.
Кстати, раз уж зашла об этом речь. Все имеющиеся на сайте программы (кроме BioMail) написаны на JavaScript и исполняются на стороне клиента. Для неискушённых в тонкостях пользователей: это означает, что если сохранить страницу с программой (формой) на локальном компьютере, то программой можно будет пользоваться, не выходя в интернет. Для тех, у кого связь ненадёжная, это может быть полезно.


раздел новостей: Софт Седьмая версия Vector NTI Suite
01.10.2001 13:01  Anonymous / Redactor           к началу страницы  комментарии: 0
Компания InforMax Inc. выпустила новую (седьмую) версию Vector NTI Suite. По сравнению с предыдущей версией расширены возможности модуля ПЦР, появились новые опции, усовершенствован алгоритм расчета праймеров. Расширена функциональность инструмента ContigExpress позволяющего собирать последовательности из большого числа коротких сиквенсовых фрагментов. Улучшен пользовательский интерфейс программы для работы с сервером BLAST (BLAST Viewer), появилась возможность пакетной обработки данных. Расширены возможности инструмента для выравнивания последовательностей ALIGNX. Некоторые улучшения внесены и в саму программу Vector NTI.
Новая версия выложена для загрузки. Это полнофункциональный продукт с демонстрационной лицензией. Внимание! Ни в коем случае не следует устанавливать программу поверх предыдущей версии, особенно если она была зарегистрированной. Во-первых базы данных совместимы лишь частично, во-вторых лицензия на предыдущую версию будет испорчена. Более подробно об этом написано здесь.

Игорь Хмельков
IKhmelkov@IBS.RU


раздел новостей: Софт Продолжение Vector NTI по русски
01.10.2001 11:59  Redactor           к началу страницы  комментарии: 0
Игорь Хмельков (IKhmelkov@IBS.RU) выложил ещё две страницы описания программы Vector NTI: "Дизайн молекул" и "Инструменты Vector NTI и Интернет".


раздел новостей: Софт Продолжение Vector NTI по русски
13.09.2001 03:45  Redactor           к началу страницы  комментарии: 0
Игорь Хмельков (IKhmelkov@IBS.RU) продолжает выкладывать описание программы Vector NTI. На этот раз "Конструирование молекул" и "ПЦР анализ при помощи Vector NTI". Большое спасибо автору и приятного чтения пользователям.

страницы (2):  1 2 >
 
Колонка новостей, спонсор — "Диаэм"
компания 'Диаэм' — cпонсор колонки новостей
поиск по каталогу Диаэм
 

  






Каталоги


Объявления





···
···

molbiol.ru для



···
 ·  Викимарт - все интернет-магазины в одном месте  · Doctor Plastic: увеличение груди - в центре Москвы  · 
···






···
 ·  отличный выбор ванны чугунные с доставкой  ·  подмосковн­­ое уполномоче­­нное туристичес­­кое агентство Coral Travel · 
···

 
 
molbiol.ru  ·  redactor@molbiol.ru  ·  реклама

molbiol.ru - методы, информация и программы для молекулярных биологов     Rambler