Главная страница MolBiol.ru > Расчёты Rambler's Top100  English version  Deutsche Version  Український варіант
ГЛАВНАЯ · ПРОЕКТ · СПРАВОЧНИК · МЕТОДЫ · РАСТВОРЫ · РАСЧЁТЫ · ЛИТЕРАТУРА · ЗАДАЧИ · FULL TEXT · ОРГ.ВОПРОСЫ · WEB
ФИРМЫ · КАРТА САЙТА · COFFEE BREAK · КАРТИНКИ · РАБОТЫ И УСЛУГИ · БИРЖА ТРУДА · ФОРУМЫ · · Zbio-wiki

Расчёты и преобразования


Нуклеотидные последовательности (НП)     >>>          
Операции с НП     >>>     
Чтение вслух НП     >>>     
Трансляция НП     >>>     
Предсказание НП по аминокислотной     >>>     
Поиск редких кодонов в кодирующей НП     >>>     
Случайная последовательность, мутагенез, перестановки НП     >>>     
Трёхбуквенный-однобуквенный код     >>>     
Анализ последовательности белка     >>>     

Вычисления     >>>          
Расчёт параметров PCR     >>>     
Спектрофотометрическое измерение концентрации нукл. кислот     >>>     
Пересчёт скорости вращения в ускорение     >>>     
Вычисление времени роста бактерий     >>>     
Связь биологического количества dNTP’s с радиоактивностью     >>>     

Конверсия     >>>          
Конверсия: масса - моли (для белков)     >>>     
Конверсия: масса - моли (для нукл. кислот)     >>>     
Конверсия ДНК/белок     >>>     
Пересчёт молярного количества в молярную концентрацию     >>>     
Конверсия единиц измерения     >>>     

Прописи растворов     >>>     
 

    Программы были подготовлены специально для "Практической молекулярной биологиии". Были автоматизированы те расчёты, которые реально полезны в лабораторной практике. Все программы написаны на JavaScript, для пользователей это означает, что если сохранить страницу на собственном компьютере, то программой можно будет пользоваться не выходя в интернет.

    Нуклеотидные последовательности

    Операции с нуклеотидной последовательностью

    Форма проводит простые манипуляции с нуклеотидной последовательностью (чтение в обратную сторону, чтение комплементарной, перевод в двухцепочечную). Она понимает стандартные обозначения полиморфных нуклеотидов. Можно проводить как одиночное преобразование, так и несколько преобразований одновременно.


    Чтение вслух нуклеотидной последовательности

    Форма читает вслух последовательность. Можно произвольно задать скорость чтения, выбрать русского или английского диктора. Есть команды "пауза" и "начать сначала". Понимаются стандартные обозначения полиморфных нуклеотидов.


    Предсказание нуклеотидной последовательности по аминокислотной

    Предсказание нуклеотидной последовательности по белковой. Учитывается частота встречаемости кодонов в лабораторных организмах: Homo sapiens, Mus musculus, Drosophila melanogaster, Arabidopsis thaliana, Saccharomyces cerevisiae, Pichia pastoris, Escherichia coli.


    Трансляция нуклеотидной последовательности

    Форма проводит трансляцию нуклеотидной последовательности в выбранных рамках считывания, при этом правильно воспринимает полиморфные нуклеотиды. Можно выбирать несколько рамок одновременно. Можно переключаться между трёхбуквенным и однобуквенным кодом.


    Поиск редких кодонов в кодирующей последовательности

    Одна из проблем при экспрессии белков связана с редкими кодонами в кодирующей последовательности. Кроме интерактивной формы, позволяющей проанализировать частоты встречаемости кодонов в конкретной последовательности, на сайте имеется таблица частоты встречаемости кодонов в распространённых лабораторных организмах.


    Случайная последовательность, мутагенез, перестановки НП

    Для моделирования или оценки работы компьютерных программ анализа удобно использовать случайные нуклеотидные последовательности. Идея программы взята с "The Sequence Manipulation Suite" /P. Stothard/. Кроме того, можно устроить перестановку определенной последовательности или её мутагенез.


    Трёхбуквенные-однобуквенные аминокислотные последовательности

    Облегчает жизнь, когда требуется перевести однобуквенную аминокислотную последовательность в трёхбуквенную (например, когда код толком не помнишь), или наоборот - переписать трёхбуквенную (например, для ввода в компьютер). Однобуквенная запись по желанию - прописными или строчными буквами. Заодно программа считает молекулярный вес белка. Идея программы взята с "The Sequence Manipulation Suite" /P. Stothard/.


    Анализ последовательности белка

    Программа рассчитывает брутто-формулу (с учетом естественного содержания изотопов), процентный состав, изоэлектрическую точку, заряд при заданном pH и молекулярный вес белков (авторы: Клименков Виталий, Широкая Александра, Авдей Алексей; http://vitalonic.narod.ru/biochem/index.html).


    Вычисления.

    Расчёт параметров PCR

    Программа помогает оценить сбалансированность PCR реакции (по нуклеотидам и праймерам) и необходимое число циклов. Рассчитывается общее количество и концентрация полученного продукта. Оценивается, с какого цикла амплификация перестаёт быть экспоненциальной. Программа сама выбирает наиболее удобные единицы измерения для представления результатов ("µg/µl", "ng/µl" или "pg/µl"). Можно выбрать единицу измерения самому, программа спорить не станет и пересчитает.


    Спектрофотометрическое измерение концентрации нукл. кислот

    Расчёт концентрации нуклеиновых кислот по оптической плотности (ДНК, РНК, олигонуклеотиды). Можно обсчитывать как одиночные измерения, так и серии измерений. Результат выводится для концентрации образца в исходной пробирке (так как учитывается разведение). Кроме того, программа разберётся, какая единица измерения будет самой удобной: "µg/µl", "ng/µl" или "pg/µl". Можно выбрать единицу измерения самому, программа пересчитает. Имеется help.


    Пересчёт скорости вращения в ускорение

    Пересчёт скорости вращения [rpm] центрифуги в ускорение [kg] и обратно. Для расчёта надо измерить (или посмотреть в описании центрифуги) радиус ротора.


    Вычисление времени роста бактерий

    "Прогнозирование" роста бактерий. Это важно при приготовлении химически компетентных и электрокомпетентных клеток, экспрессии белков. Программу можно использовать и для других организмов на логарифмической стадии роста. Кроме того, оценивается точность прогноза. Имеется help.


    Связь биологического количества dNTP’s с радиоактивностью

    Пересчёт активности меченных дидезоксинуклеотидов в массу и молярное количество. Это бывает полезно при оценке того, сколько матрицы следует брать для меченья ДНК или РНК.


    Конверсия

    Конверсия: масса - моли (для белков).

    Пересчёт для белка с известным молекулярным весом массы (или весовой концентрации) в моли (или молярную концентрацию) и обратно. Программа разберётся, какая единица измерения будет самой удобной, например "mol", "mmol", "µmol", "nmol", "pmol", "fmol" или "amol". Можно выбрать единицу измерения самому, программа спорить не станет и пересчитает. Имеется help.


    Конверсия: масса - моли (для нукл. кислот)

    Пересчёт для нукл. кислот (ДНК, РНК, олигонуклеотид) массы (или весовой концентрации) в моли (или молярную концентрацию) и обратно. Программа разберётся, какая единица измерения будет самой удобной, например "mol", "mmol", "µmol", "nmol", "pmol", "fmol" или "amol". Можно выбрать единицу измерения самому, программа спорить не станет и пересчитает. Имеется help.


    Конверсия ДНК/белок

    Простенькая оценка, какого размера требуется ген для синтеза белка данного молекулярного веса и наоборот, какого размера получится белок для ORF данного размера.


    Пересчёт молярного количества в молярную концентрацию

    Пересчёт молярного количества [mol] в молярную концентрацию [M]. Нужно задать объём раствора и всё. Программа разберётся, какая единица измерения будет самой удобной, например "mol", "mmol", "µmol", "nmol", "pmol", "fmol" или "amol". Можно выбрать единицу измерения самому, программа спорить не станет и пересчитает. Имеется help.


    Конверсия единиц измерения

    Пересчёт единиц измерения. Например: сколько миллиметров в дюйме. Пересчёты для длины; площади; объёма; угла; времени; скорости; ускорения; силы; давления; энергии; мощности; массы; температуры и радиоактивности. Кратные и дольные приставки. Практически все физические величины. Если чего то не хватает, пишите, добавим. Имеется help.


    Прописи растворов

    Таблицы с прописями приготовления растворов позволяют рассчитывать количество реактивов для произвольных объёмов. Таблицы работают следующим образом: в крайнюю правую верхнюю позицию таблицы нужно ввести финальный объем раствора в. После нажатия на кнопку "Расчёт" (или клика вне этогй позиции) будут вычисленны веса/объёмы всех компонентов раствора для указанного объёма.

    Прописи для обычно используемых растворов можно найти в главе "Приготовление растворов". Кроме того, в протоколах имеются собственные списки реактивов. Они тоже обеспечивают пересчёт (например, пропись для приготовления белкового геля).

    Инструкция по работе с прописями растворов откроется в новом окне при нажатии на эту кнопку:   



MolBiol.ru: http://molbiol.ru
e-mail: redactor@molbiol.ru
просмотров: 323389


Смотри также:
/ссылки на сетевые ресурсы/



    Дополнения, комментарии, вопросы

    pilgrim /30.10.2006 13:31/
    Предлагаю пользователям molbiol на рассмотрение созданную мною утилиту для рассчета параметров олигонуклеотидов.
    Утилиту можно найти здесь - OligoCalculator v1.0 ( http://andrew3d.net/index.php?page_id=3005 ).

    Привествуются комментарии и замечания по улучшению утилиты.



    Гость /22.02.2008 08:58/
    >gi|22538412|ref|NM_148899.1| Homo sapiens forkhead box P2 (FOXP2), transcript variant 3, mRNA
    AGTGAGCTAGCTTCTGAGTTTTCCCTTCTTTTTATACTGTTTTCTGTGCTGGCTTTTTTGAATCTTCCTA
    ATTTTTCATCTCTTTAACAAACTCCTATGAAGTTGAAACCGGGAAGTTTGCTCTAACATTTCCAGAGAAG
    GTATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATG
    AGCACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACCAGCTCTGAAG
    TAAGCACAGTAGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCAGCAAGACAACTTCTTTTACA
    GCAGCAAACAAGTGGATTGAAATCTCCTAAGAGCAGTGATAAACAGAGACCACTGCAGCAGCCATGAGAC
    AGACTTGTGGTTCTTCAACAGCTGTGCAGAGCAGAGACGTAAATTTAAGGTGTGCCTGTGTCAGTGGCCA
    TGATGACTCCCCAGGTGATCACCCCTCAGCAAATGCAGCAGATCCTTCAGCAACAAGTCCTGTCTCCTCA
    GCAGCTACAAGCCCTTCTCCAACAACAGCAGGCTGTCATGCTGCAGCAGCAACAACTACAAGAGTTTTAC
    AAGAAACAGCAAGAGCAGTTACATCTTCAGCTTTTGCAGCAGCAGCAGCAACAGCAGCAGCAGCAACAAC
    AGCAGCAACAACAGCAGCAGCAACAACAACAACAACAGCAGCAACAACAGCAGCAGCAGCAGCAACAGCA
    GCAGCAGCAGCAACAGCATCCTGGAAAGCAAGCGAAAGAGCAGCAGCAGCAGCAGCAGCAGCAACAGCAA
    TTGGCAGCCCAGCAGCTTGTCTTCCAGCAGCAGCTTCTCCAGATGCAACAACTCCAGCAGCAGCAGCATC
    TGCTCAGCCTTCAGCGTCAGGGACTCATCTCCATTCCACCTGGCCAGGCAGCACTTCCTGTCCAATCGCT
    GCCTCAAGCTGGCTTAAGTCCTGCTGAGATTCAGCAGTTATGGAAAGAAGTGACTGGAGTTCACAGTATG
    GAAGACAATGGCATTAAACATGGAGGGCTAGACCTCACTACTAACAATTCCTCCTCGACTACCTCCTCCA
    ACACTTCCAAAGCATCACCACCAATAACTCATCATTCCATAGTGAATGGACAGTCTTCAGTTCTAAGTGC
    AAGACGAGACAGCTCGTCACATGAGGAGACTGGGGCCTCTCACACTCTCTATGGCCATGGAGTTTGCAAA
    TGGCCAGGCTGTGAAAGCATTTGTGAAGATTTTGGACAGTTTTTAAAGCACCTTAACAATGAACACGCAT
    TGGATGACCGAAGCACTGCTCAGTGTCGAGTGCAAATGCAGGTGGTGCAACAGTTAGAAATACAGCTTTC
    TAAAGAACGCGAACGTCTTCAAGCAATGATGACCCACTTGCACATGCGACCCTCAGAGCCCAAACCATCT
    CCCAAACCTCTAAATCTGGTGTCTAGTGTCACCATGTCGAAGAATATGTTGGAGACATCCCCACAGAGCT
    TACCTCAAACCCCTACCACACCAACGGCCCCAGTCACCCCGATTACCCAGGGACCCTCAGTAATCACCCC
    AGCCAGTGTGCCCAATGTGGGAGCCATACGAAGGCGACATTCAGACAAATACAACATTCCCATGTCATCA
    GAAATTGCCCCAAACTATGAATTTTATAAAAATGCAGATGTCAGACCTCCATTTACTTATGCAACTCTCA
    TAAGGCAGGCTATCATGGAGTCATCTGACAGGCAGTTAACACTTAATGAAATTTACAGCTGGTTTACACG
    GACATTTGCTTACTTCAGGCGTAATGCAGCAACTTGGAAGAATGCAGTACGTCATAATCTTAGCCTGCAC
    AAGTGTTTTGTTCGAGTAGAAAATGTTAAAGGAGCAGTATGGACTGTGGATGAAGTAGAATACCAGAAGC
    GAAGGTCACAAAAGATAACAGGAAGTCCAACCTTAGTAAAAAATATACCTACCAGTTTAGGCTATGGAGC
    AGCTCTTAATGCCAGTTTGCAGGCTGCCTTGGCAGAGAGCAGTTTACCTTTGCTAAGTAATCCTGGACTG
    ATAAATAATGCATCCAGTGGCCTACTGCAGGCCGTCCACGAAGACCTCAATGGTTCTCTGGATCACATTG
    ACAGCAATGGAAACAGTAGTCCGGGCTGCTCACCTCAGCCGCACATACATTCAATCCACGTCAAGGAAGA
    GCCAGTGATTGCAGAGGATGAAGACTGCCCAATGTCCTTAGTGACAACAGCTAATCACAGTCCAGAATTA
    GAAGACGACAGAGAGATTGAAGAAGAGCCTTTATCTGAAGATCTGGAATGAGAACTGACTTGTGAAACCT
    CAGCGTGAAGGGACATATCACTGACCTTCATAACCACTCCACAACCATGAATATTTGACAAATTTTTACT
    GTGACTATTTATTAAGCATGGATAAAGGAGACAGCCCTAAAGGAACTTACTAAGCCAGCCCTTTGGGATT
    CAGTACCAACAGGCA

    >gi|57113920|ref|NM_001009020.1| Pan troglodytes forkhead box P2 (FOXP2), mRNA
    TGAGCTAGCTTCTGAGTTTTCCCTTCTTTTTATACTGTTTTCTGCGCTGGCTTTTTTGAATCTTCCTAAT
    TTTTCATCTCTTTAACAAACTCCTATGAAGTTGAAACCGGGAAGTTTGCTCTAACATTTCCAGAGAAGGT
    ATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATGAG
    CACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACCAGCTCTGAAGTA
    AGCACAGTAGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCGGCAAGACAACTTCTTTTACAGC
    AGCAAACAAGTGGATTGAAATCTCCTAAGAGCAGTGATAAACAGAGACCACTGCAGGTGCCTGTGTCAGT
    GGCCATGATGACTCCCCAGGTGATCACCCCTCAGCAAATGCAGCAGATCCTTCAGCAACAAGTCCTGTCT
    CCTCAGCAGCTCCAAGCCCTTCTCCAACAACAGCAGGCTGTCATGCTGCAGCAGCAACAACTACAAGAGT
    TTTACAAGAAACAGCAAGAGCAGTTACATCTTCAGCTTTTGCAGCAGCAGCAGCAACAGCAGCAGCAGCA
    ACAACAGCAGCAACAACAGCAGCAGCAACAACAACAACAGCAGCAGCAGCAACAACAGCAGCAGCAGCAG
    CAACAGCAGCAGCAGCAGCAACAGCATCCTGGAAAGCAAGCGAAAGAGCAGCAGCAGCAGCAGCAGCAGC
    AACAGCAATTGGCAGCCCAGCAGCTTGTCTTCCAGCAGCAGCTTCTCCAGATGCAACAACTCCAGCAGCA
    GCAGCATCTGCTCAGCCTTCAGCGTCAGGGACTCATCTCCATTCCACCTGGCCAGGCAGCACTTCCTGTC
    CAATCGCTGCCTCAAGCTGGCTTAAGTCCTGCTGAGATTCAGCAGTTATGGAAAGAAGTGACTGGAGTTC
    ACAGTATGGAAGACAATGGCATTAAACATGGAGGGCTAGACCTCACTACTAACAATTCCTCCTCGACTAC
    CTCCTCCACCACTTCCAAAGCGTCACCACCAATAACTCATCATTCCATCGTGAATGGACAGTCTTCAGTT
    CTAAATGCAAGACGAGACAGCTCGTCACATGAGGAGACTGGGGCCTCTCACACTCTCTATGGCCATGGAG
    TTTGCAAATGGCCAGGCTGTGAAAGCATTTGTGAAGATTTTGGACAGTTTTTAAAGCACCTTAACAATGA
    ACACGCATTGGATGACCGAAGCACTGCTCAGTGTCGAGTGCAAATGCAGGTGGTGCAACAGTTAGAAATA
    CAGCTTTCTAAAGAACGCGAACGTCTTCAAGCAATGATGACCCACTTGCACATGCGACCCTCAGAGCCCA
    AACCATCTCCCAAACCTCTAAATCTGGTGTCTAGTGTCACCATGTCGAAGAATATGTTGGAGACATCCCC
    ACAGAGCTTACCTCAAACCCCTACCACACCAACGGCCCCAGTCACCCCGATTACCCAGGGACCCTCAGTA
    ATCACCCCAGCCAGTGTGCCCAATGTGGGAGCCATACGAAGGCGACATTCAGACAAATACAACATTCCCA
    TGTCATCAGAAATTGCCCCAAACTATGAATTTTATAAAAATGCAGATGTCAGACCTCCATTTACTTATGC
    AACTCTCATAAGGCAGGCTATCATGGAGTCATCTGACAGGCAGTTAACACTTAATGAAATTTACAGCTGG
    TTTACACGGACATTTGCTTACTTCAGGCGTAATGCAGCAACTTGGAAGAATGCAGTACGTCATAATCTTA
    GCCTGCACAAGTGTTTTGTTCGAGTAGAAAATGTTAAAGGAGCAGTATGGACTGTGGATGAAGTAGAATA
    CCAGAAGCGAAGGTCACAAAAGATAACAGGAAGTCCAACCTTAGTAAAAAATATACCTACCAGTTTAGGC
    TATGGAGCAGCTCTTAATGCCAGTTTGCAGGCTGCCTTGGCAGAGAGCAGTTTACCTTTGCTAAGTAATC
    CTGGACTGATAAATAATGCATCCAGTGGCCTACTGCAGGCCGTCCACGAAGACCTCAATGGTTCTCTGGA
    TCACATCGACAGCAATGGAAACAGTAGTCCGGGCTGCTCACCTCAGCCGCACATACATTCAATCCACGTC
    AAGGAAGAGCCAGTGATTGCAGAGGATGAAGACTGCCCAATGTCCTTAGTGACAACAGCTAATCACAGTC
    CAGAATTAGAAGACGACAGAGAGATTGAAGAAGAGCCTTTATCTGAAGATCTGGAATGAGAACTGACTTG
    TGAAACCTCAGCGTGAAGGGACATATCACTGACCTTCATAACCACTCCACAACCATGAATATTTGACAAA
    TTTTTACTGTGACTATTTATTAAGCATGGATAAAGGAGACAGCCCTAAAGGAACTTACTAAGCCAGCCCT
    TTGGGATTCA



    Гость /22.02.2008 09:06/
    gi|22538412|ref|NM_148899.1| Homo sapiens forkhead box P2 (FOXP2), transcript variant 3, mRNA
    AGTGAGCTAGCTTCTGAGTTTTCCCTTCTTTTTATACTGTTTTCTGTGCTGGCTTTTTTGAATCTTCCTA
    ATTTTTCATCTCTTTAACAAACTCCTATGAAGTTGAAACCGGGAAGTTTGCTCTAACATTTCCAGAGAAG
    GTATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATG
    AGCACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACCAGCTCTGAAG
    TAAGCACAGTAGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCAGCAAGACAACTTCTTTTACA
    GCAGCAAACAAGTGGATTGAAATCTCCTAAGAGCAGTGATAAACAGAGACCACTGCAGCAGCCATGAGAC
    AGACTTGTGGTTCTTCAACAGCTGTGCAGAGCAGAGACGTAAATTTAAGGTGTGCCTGTGTCAGTGGCCA
    TGATGACTCCCCAGGTGATCACCCCTCAGCAAATGCAGCAGATCCTTCAGCAACAAGTCCTGTCTCCTCA
    GCAGCTACAAGCCCTTCTCCAACAACAGCAGGCTGTCATGCTGCAGCAGCAACAACTACAAGAGTTTTAC
    AAGAAACAGCAAGAGCAGTTACATCTTCAGCTTTTGCAGCAGCAGCAGCAACAGCAGCAGCAGCAACAAC

    >gi|57113920|ref|NM_001009020.1| Pan troglodytes forkhead box P2 (FOXP2), mRNA
    TGAGCTAGCTTCTGAGTTTTCCCTTCTTTTTATACTGTTTTCTGCGCTGGCTTTTTTGAATCTTCCTAAT
    TTTTCATCTCTTTAACAAACTCCTATGAAGTTGAAACCGGGAAGTTTGCTCTAACATTTCCAGAGAAGGT
    ATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATGAG
    CACTCTAAGCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACCAGCTCTGAAGTA
    AGCACAGTAGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCGGCAAGACAACTTCTTTTACAGC
    AGCAAACAAGTGGATTGAAATCTCCTAAGAGCAGTGATAAACAGAGACCACTGCAGGTGCCTGTGTCAGT
    GGCCATGATGACTCCCCAGGTGATCACCCCTCAGCAAATGCAGCAGATCCTTCAGCAACAAGTCCTGTCT
    CCTCAGCAGCTCCAAGCCCTTCTCCAACAACAGCAGGCTGTCATGCTGCAGCAGCAACAACTACAAGAGT
    TTTACAAGAAACAGCAAGAGCAGTTACATCTTCAGCTTTTGCAGCAGCAGCAGCAACAGCAGCAGCAGCA
    ACAACAGCAGCAACAACAGCAGCAGCAACAACAACAACAGCAGCAGCAGCAACAACAGCAGCAGCAGCAG
    CAACAGCAGCAGCAGCAGCAACAGCATCCTGGAAAGCAAGCGAAAGAGCAGCAGCAGCAGCAGCAGCAGC
    AACAGCAATTGGCAGCCCAGCAGCTTGTCTTCCAGCAGCAGCTTCTCCAGATGCAACAACTCCAGCAGCA
    GCAGCATCTGCTCAGCCTTCAGCGTCAGGGACTCATCTCCATTCCACCTGGCCAGGCAGCACTTCCTGTC
    CAATCGCTGCCTCAAGCTGGCTTAAGTCCTGCTGAGATTCAGCAGTTATGGAAAGAAGTGACTGGAGTTC
    ACAGTATGGAAGACAATGGCATTAAACATGGAGGGCTAGACCTCACTACTAACAATTCCTCCTCGACTAC
    CTCCTCCACCACTTCCAAAGCGTCACCACCAATAACTCATCATTCCATCGTGAATGGACAGTCTTCAGTT
    CTAAATGCAAGACGAGACAGCTCGTCACATGAGGAGACTGGGGCCTCTCACACTCTCTATGGCCATGGAG
    TTTGCAAATGGCCAGGCTGTGAAAGCATTTGTGAAGATTTTGGACAGTTTTTAAAGCACCTTAACAATGA



    Дядя ФАКСер /18.09.2008 20:19/
    (ДЕЖУРНЫЙ ПО КОСМОСУ @ 18.09.2008 08:01)
    Ссылка на исходное сообщение  Возможно ли с помощью хим. раекции некоторых соединений создать в капсуле огромное (милионное)давление при малых затратах вещества

    "Гранату в рот- и выдернуть чеку" smile.gif



    Miss Marple /23.02.2011 16:28/
    Уважаемые,
    есть ли у кого-нибудь калькулятор еффективности ФРЕТ? Например, при известном изменении расстояния между парой донор/акцептор (и известном Фёрстр-радиусе)? А также "наоборот": вычисление расстояния при известной эффективности ФРЕТ?



    chivalry /16.11.2011 14:37/





       
Дата последней модификации: 30/07/13

ГЛАВНАЯ · ПРОЕКТ · СПРАВОЧНИК · МЕТОДЫ · РАСТВОРЫ · РАСЧЁТЫ · ЛИТЕРАТУРА · ЗАДАЧИ · FULL TEXT · ОРГ.ВОПРОСЫ · WEB
ФИРМЫ · КАРТА САЙТА · COFFEE BREAK · КАРТИНКИ · РАБОТЫ И УСЛУГИ · БИРЖА ТРУДА · ФОРУМЫ · · Zbio-wiki

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---

molbiol.ru  ·  redactor@molbiol.ru  ·  реклама

molbiol.ru - методы, информация и программы для молекулярных биологов   Rambler