Library amplification

Материал из Zbio

Перейти к: навигация, поиск

Illumina / SOLiDSOLiD / Illumina

Содержание


NB! real time and large-scale PCR are assembled in pre-PCR area. Manipulations with amplified material are in post-PCR area.


[править] RT-PCR analysis[1]

  • check, that you have:
» analytical 2% HR TAE gel for PCR serial dilutions
» preparative agarose gels for fractionation of amplified library
» QIAquick spin-columns to use after:
PCR
fractionation of amplified library
» scalpels
» low size-range DNA marker
» rotator at NT


  1. prepare RT-PCR mix in ice-bath:
    conc.
    SYBRGreen buffer*, 10x1x
    dNTPs with dUTP, 12.5mM1.25mM
    MgCl2, 25mM2.5mM
    primer 1**, 10µM0.4µM
    primer 2**, 10µM0.4µM
    DNA library 
    H2OmQ
    Immolase***, 5u/µl0.025u/µl

     * SYBR Green PCR core reagents kit from ABI, #4304886
     ** use following primer pairs:

    » library for SR: "PCR primer 2.1[2]" and "adapter primer 1[3]"
    » library for PE: "#611[4]" and "adapter primer 1[3]"

     *** Bioline #BIO-21046. It is also possible to use AmpliTaq Gold, 5u/µl; ABI, but PCR efficiency and yield will be lower



  2. PCR program[5][6]:
    1. 95°C, 10:00
    2. 95°C, 0:15
    3. 65°C, 0:30
    4. 72°C, 0:30
    5. go to 2, 39 times
    6. melt curve analysis


  3. rough estimation of the complexity of the library[7]:
    Variable
    mean size of PCR-fragments[size]
    middle of logarifmic stage[A] cycles
    complexity per 1µl of unamplified library[com]

    * usually we get:
    » starting from ~0.5µg of genomic DNA: A~6-7
    » starting from ~0.1-0.2µg of polyA+ RNA: A~13
  1. prepare PCR mix (in ice-bath):
    Invitrogen PCR SuperMix
    PCR primer 1, 50µM
    PCR primer 2, 50µM
    total:

  2. put 18µl into the first PCR tube and 10µl into the other 9 tubes (in ice-bath);
  3. put 2µl of the library into the first tube, make 2x serial dilutions in tubes 1-9 and leave the tube 10 as a 0-control;
  4. two control tubes for primers:
    • tube 11: 10µl of Invitrogen PCR SuperMix & 0.5µl PCR primer 1, 50µM;
    • tube 12: 10µl of Invitrogen PCR SuperMix & 0.5µl PCR primer 2, 50µM;
  5. PCR-titration program:
    1. 72°C, 20:00 // nick-translation
    2. 95°C, 5:00
    3. 95°C, 0:15
    4. 62°C, 0:15
    5. 70°C, 1:00
    6. go to 2, 14 times
    7. 4°C, hold
  6. analyse on agarose gel;
  7. estimation of the complexity of the library[8]:
    Variable
    mean size of PCR-fragments[size]
    tube number, where desired band start to be visible (~25ng)[A]
    complexity per 1µl of unamplified library[com]



[править] Library amplification

  • at least 1/3 of the library should be taken for large-scale amplification[9]
  • it is important to avoid overamplification[10]
  1. set-up large-scale PCR reaction (in ice-bath):
    mean size of PCR-fragments [size]
    middle of logarifmic stage: [A] cycles
    number of cycles in large-scale PCR [N]*
    DNA
    PCR primer 1**, 20µM
    PCR primer 2**, 20µM
    2x Master Mix***
    H2O

     * number of cycles of large-scale PCR:
       N = A - log2{(Vsample[µl]/Vreaction[µl]) / (1[µl] / 20[µl])}
     ** use following primer pairs:
         » library for SR: "PCR primer 1.1" (5’ - ??? - 3’) and "PCR primer 2.1" (5’ - ??? - 3’)
         » library for PE: "PE_PCR primer 1.1" (5’ - ??? - 3’) and "PE_PCR primer 2.1" (5’ - ??? - 3’)
     *** 2x Phusion HF Master Mix (NEB, #F-531L)


  2. PCR program:
    1. 98°C, 0:30
    2. 98°C, 0:10
    3. 65°C, 0:30
    4. 72°C, 0:30
    5. go to 2, repeat:
    6. 4°C, hold


  3. if PCR is performed in 30µl or less — load it on the gel without preliminary purification, otherwice QIAquick purification:
    • 5xPB:
    • // total:

    • elute with 30µl EB (2x16µl)

  1. set-up large-scale PCR reaction (in ice-bath):
    mean size of PCR-fragments [size]
    tube number [A], where desired band start to be visible (~25ng)
    number of cycles in large-scale PCR [N]
    DNA
    Invitrogen PCR SuperMix
    Pfu polymerase, 2.5u/µl
    PCR primer 1, 50µM
    PCR primer 2, 50µM



    number of cycles of large-scale PCR:
       15-log2{(Vsample[µl]/Vreaction[µl]) / (1µl / 10µl / 2N-1)} = 16 - N - log2{10*Vsample/Vreaction}


  2. QIAquick purification:
    • PB:
    • // total:

    • elute with 40µl EB (2x21µl);



[править] Library size-fractionation

  • prepare 2% high-resolution agarose gel with individual wells (typical output is less than 3µg and may be loaded on one well)
  • for each library prepare labeled (#lib) tube


  1. run the gel;
  2. cut out desired fragments as one block:
    • length of adapters:
    » library for SR: 58 + 34 = 92bp
    » library for PE: 58 + 61 = 119bp
    » library for MuPl: 58 + 64 = 122bp
    • length of adapters:??bp


  3. QG-gel extraction, elute in 50µl EB (2x26µl):
    volume500µl
    DNA1xV100µl
    QG buffer3xV300µl
    Isopropanol1xV100µl

  4. determine concentration on Qubit: HS kit;
  5. add 5µl of 1% Tween 20[11];
  6. store at -20°C



[править] Library complexity[12]

  1. evaluate (i) library complexity and (ii) sequencing plans:
    number of cycles of large-scale PCR [N]
    amount of purified DNA [m], ng
    mean size of purified DNA [size], kb
    library complexity [com], molecules

  2. compare complexity "COM" with a planned amount of sequencing reads "READS":
    • 5x READS < COM: everything is fine
    • 1x READS < COM < 5xREADS: it is possible to sequence library, but significant number of reads will be a clone of each other
    • COM < 1x READS: it worth to prepare additional library (new library, or amplify the rest of material) or change a plan for sequencing


[править] References

  1. RT-PCR analysis is used to:
    • determine the complexity of the library and number of cycles for large-scale PCR
    • estimate library quality by melting curve analysis
  2. PCR primer 2.1: #601, 5’ - CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT - 3’
  3. 3,0 3,1 adapter primer 1: #603, 5’ - TACACTCTTTCCCTACACGACGCTCTTCCGATCT - 3’
  4. #611: partly complementary to PE adapter primer 2, 5' – GGCATTCCTGCTGAACCGCTCTTCCGATCT - 3'
  5. start PCR program, pause on 95°C, install tubes and resume pause
  6. do not use final 5-10 min 70-72°C extension. In this protocol it is completely useless
  7. rough estimation of the complexity (Illumina):
       com ~ 0.1µg / (2A * size[kb] * 103 * 2 * 330g/mol) * NAvogadro[1/mol] = 1011 / (2A * size[kb])
  8. rough estimated of complexity (SOLiD):
       com ~ {~25ng * 2N-1 / 215} / (size[kb] * 103 * 2 * 330g/mol) * NAvogadro[mol-1] = 3x105 * 2N / size[kb]
  9. ~1/3 of the library should be taken for large-scale amplification:
    • there is still enough material to repeat amplification if something fails
    • if take less it will be unreasonable reduction of the library complexity
  10. overamplification is dangerous, because:
    • most important: overamplified DNA contains hetero-hybrids. It will result in hetero-amplified beads in emulsion PCR
    • DNA-profile will be distorted during overamplification
  11. so, library will be in {EBQiagen with 0.1% Tween 20}. Detergent prevents DNA sticking to the walls of the tube
  12. Library complexity is a number of independent molecules within the library. "Independent" means: obtained from the original DNA material, but not as a result of clonal amplification of the same fragment. Library complexity may be significantly overestimated if calculated from the amount of unamplified library, because it contains a lot of unamplifiable fragments, adapters, etc. The most reliable estimation is after gel-purification of amplified library:
    m[ng] / (2N * size[kb] * 1000 * 2 * 330[g/mol]) * NAvogadro = 109 * m[ng] / (2N * size[kb])


Личные инструменты


Инструменты




molbiol.ru  ·  redactor@molbiol.ru  ·  реклама

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---


molbiol.ru - методы, информация и программы для молекулярных биологов     Rambler's Top100 Rambler