Optimal library concentration for sequencing

Материал из Zbio

Перейти к: навигация, поиск
problems/questions

 Problem list:



Mol.biology // Next-generation sequencing

;

Содержание


NB! pre-PCR operation


[править] Real-Time PCR

NB! measurement of library concentration by Real-Time PCR should be performed as close as possible to loading. Repeat measurement, if the last one was done more than 3 monthes ago [1]


  1. calculate the number of RT PCR reactions: "N of samples" + positive control + negative control[2];
  2. prepare RT-PCR common mix in ice-bath:
    conc.1x
    SYBRGreen buffer*, 10x1x2µl
    dNTPs with dUTP, 12.5mM1.25mM2µl
    MgCl2, 25mM2.5mM2µl
    primer 1**, 10µM0.4µM0.8µl
    primer 2**, 10µM0.4µM0.8µl
    H2O, mQ 11.3µl
    Immolase***, 5u/µl25u/ml0.1µl
    total19µl

     * SYBR Green PCR core reagents kit from ABI, #4304886
     ** use following primer pairs:

    » library for SR: "PCR primer 2.1[3]" and "adapter primer 1[4]"
    » library for PE: "#611[5]" and "adapter primer 1[4]"

     *** Bioline #BIO-21046. It is also possible to use AmpliTaq Gold, 5u/µl; ABI, but PCR efficiency and yield will be lower


  3. distribute RT mix to 100µl optical RT-PCR tubes/strips: 19µl in each tube;
  4. store RT-PCR tubes on ice;
  5. put back RT PCR reagents;
  6. prepare libraries (up to 20nM):

    --- in post-PCR room ---

    » melt libraries
    » wortex
    » spin down
    » if necessary, measure concentration and prepare 10nM dilution
    » install library tubes into tube-holder
    » bring tube-holder into post-PCR room, put it on a piece of paper towel[6]
  7. add 1 µl of library solutions to RT tubes;
  8. wash, or put on new gloves;
  9. close tubes/strips tightly, mix by finger tapping, spin down;
  10. start PCR program [7][8]:
    1. 95°C, 10:00
    2. 95°C, 0:15
    3. 65°C, 0:30
    4. 72°C, 0:30
    5. go to 2, 39 times
    6. melt curve analysis
  11. bring library tubes back to post-PCR room:
    » snap freeze them in liquid nitrogen
    » store at -20°C[10]
  12. determine the optimal loading concentration for each library[9]
    referenceanalysis
    mean size
    stock
    number of cycles exp. phase of analysis library LATER than that of reference
    opt. loading




[править] Library stock preparation

  1. (if not already done) determine library concentration on Qubit: HS kit;
  2. if library concentration is more, than >20nM prepare 10nM dilution in LSB[2];

  3. library
       » mean size (with adapters):
       » weight conc.:
       » molar conc.:




[править] Optimal concentration for loading

should be done after "first base report"


  1. on the basis "loading concentration" and "number of clusters per tile" from the first base report calculate the optimal loading concentration:
    result
    realoptimal
    number of clusters per tile [mln]
    loading concentration [pM]


  2. insert it as a coment into library database




[править] Notes

  • LSB: EB, 0.1% Tween20
  • benefits:
» high sensitivity
» detection of only amplifiable sequences




[править] Open questions

this protocol uses different "reference libraries" for optimization of library loading. It may lead to "double mistakes"

» one occasional mistake during library loading (for example, pipetting mistake)
» would lead to the "calculation mistake" for the next library.

It is worth to prepare a large amount of "reference standard, aliquote it, and use as a "stable reference". It also gives a possibility to control RT PCR itself, because "stable reference" should rize on the same cycle.



[править] See also

qPCR for quantification of NGS libraries




  1. for low concentrated libraries concentration may decrease upon storage or repeated thawing/freezing cycles
  2. RT PCR controls:
    • positive control: <20nM stock (freshly prepared every month) of previously sequenced library, for which the optimal loading concentration is known
    • negative: H2O, mQ
  3. PCR primer 2.1: #601, 5’ - CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT - 3’
  4. 4,0 4,1 adapter primer 1: #603, 5’ - TACACTCTTTCCCTACACGACGCTCTTCCGATCT - 3’
  5. #611: partly complementary to PE adapter primer 2, 5' – GGCATTCCTGCTGAACCGCTCTTCCGATCT - 3'
  6. library stock may cause contamination. Tube holder from post-PCR room should not contact things (table) in the pre-PCR room
  7. artificial hot start: start PCR program, pause on 95°C, install tubes and resume pause
  8. do not use final 5-10 min 70-72°C extension. In this protocol it is completely useless
  9. optimal loading concentration for the reference library should be calculated on the basis of real sequencing


Личные инструменты


Инструменты




molbiol.ru  ·  redactor@molbiol.ru  ·  реклама

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---


molbiol.ru - методы, информация и программы для молекулярных биологов     Rambler's Top100 Rambler