Sequences, oligonucleotides

Материал из Zbio

Перейти к: навигация, поиск

Содержание

[править] Fragmented library

[править] Illumina


[править] SOLiD




[править] Paired-End library

[править] Illumina




[править] Mate-Paired library (EcoP15I)

[править] Illumina


[править] SOLiD




[править] Mate-Paired library (nick translation)

[править] Nick translation


[править] Illumina


[править] SOLiD




[править] List of oligonucleotides

namelength [nt]sequence [5'-->3']notes
Illumina
Ad_134TACACTCTTTCCCTACACGACGCTCTTCCGATCxTx-phosphorothioate bond
Ad_233P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGphosphorylated, 3' end blocked
Ad_2PE32P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGphosphorylated, 3' end blocked
PCR_158AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCxTx-phosphorothioate bond
PCR_234CAAGCAGAAGACGGCATACGAGCTCTTCCGATCxTx-phosphorothioate bond
PCR_2PE61CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCxTx-phosphorothioate bond link
Seq_133ACACTCTTTCCCTACACGACGCTCTTCCGATCT 
Seq_237CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT 
SOLiD
P1_141CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATP1 adapter
P1_243P-ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTTP1 adapter; phosphorylated, 3' end blocked
P2_123CTGCCCCGGGTTCCTCATTCTCTP2 adapter
P2_225P-AGAGAATGAGGAACCCGGGGCAGTTP2 adapter; phosphorylated, 3' end blocked
PCR primer 128CCACTACGCCTCCGCTTTCCTCTCTATG 
PCR primer 221CTGCCCCGGGTTCCTCATTCT 
Mate-Paired library
Eco_19P-CTGCTGTACEcoP15I CAP adaptor; phosphorylated
Eco_27P-ACAGCAGEcoP15I CAP adaptor; phosphorylated
LMP_19P-CTGCTGTACLMP CAP adaptor; phosphorylated
LMP_27ACAGCAGLMP CAP adaptor
Int_120P-CGTACATBioCCgCCTTGGCCGTInt. adaptor; phosphorylated
Int_220P-GGCCAAGGCGGATGTACGGTInt. adaptor; phosphorylated


Личные инструменты


Инструменты




molbiol.ru  ·  redactor@molbiol.ru  ·  реклама

 ·  Викимарт - все интернет-магазины в одном месте  ·  Доска объявлений Board.com.ua  · 
--- сервер арендован в компании Hetzner Online, Германия ---
--- администрирование сервера: Intervipnet ---


molbiol.ru - методы, информация и программы для молекулярных биологов     Rambler's Top100 Rambler